pycom12463g00060

Nudix hydrolase 3-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00012463
Physical Location & Seq
Forward (+)
21964 .. 32818
10855 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom12463g00060.6

Sequence Viewer

Length: 930 bp
ATGTGCATGTGGCTGTCAAACTCATCGAACCTTAGCTTGGAATTGAGCCTTAACAGTGATACGGGCGCGCCGCGTCAAGGTAACGTATGGCGCCCTTCTTTCTTATCTTCTAACGGTCTTCTTACAGGTGAAGACTCCGTGATGCAGGACGCCACAACAGCTACAATAGTAGCTAGGAACCTCCTCACTCCAAAAGATAGTAGGCTGCTGTCAGGACGGTCCGATGAGTTAGCCGTTCAAGAATCCCTCGCTCTTAGTGTTCAGTGTGCGAGCTCTGTGTCCAACATGGGCCAACGCCTGCTTGCCCGCTCCCGTCAGGTGGAATCATTGATGGCAGAGGTGGAAAGTCTTAAGCAAGAGATTCAGCAACTTAAGTACGAGAATAGAAGTTTGCATGTGCTTGCAAATAACTATTCGTCGGGCAGGAAGAGGAAGCTTAATGAACTGCAAGAGTCTGAAGGTCGGATTCAAAGCGACCATCAAAGGTTTTCTGCTTATCTCCAGAGGCACCTTTTTCCTGGCTCATCCAGCGCTTGGCCAATTATTGAGGCCTGGAATGCTCTATCTTCGATGCCTCCCGCTCCGATGCCTTCCGCTCCGATGTATTCCGCTCCGATGCCTTCCGCTTCGATGCCTTCCGCTCCGATGCCTTCCGCTCCGACGCCTCATAGTGGGGCTTCACGTAAACAACCTTTTTTATGGAAGAGTGAACAAGTGCATGTGGCTGCATTGTGGATTGAATGTGCATGTGGCTGCAATGGATTAGGAATCCTTCAATTTCGTCCATCCTCTTGTTCGTCCATTCCTTTTGCTCCAAGCATAAGCTATCCATTCCAAGCCCAATTTTGCTCCAAAATGCTCCAAAATGCACCTTTTTGCTTCCTTAGCCATATGAACCTAAAAACACACGAAAATGGCTTAAACTACTAA

Protein Analysis

310

Amino Acids

33.96

Weight (kDa)

8.42

Isoelectric Point (pI)

70.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 90, 507
AccB7I CCANNNNNTGG 1 cut(s) 534
AccBSI CCGCTC 6 cut(s) 309, 581, 596, 611, 641, 656
AccII CGCG 2 cut(s) 68, 73
AciI CCGC 8 cut(s) 71, 307, 579, 594, 609, 624, 639, 654
AcoI YGGCCR 1 cut(s) 536
AcuI CTGAAG 1 cut(s) 477
AcyI GRCGYC 3 cut(s) 91, 150, 662
AfaI GTAC 1 cut(s) 377
AfeI AGCGCT 1 cut(s) 532
AfiI CCNNNNNNNGG 5 cut(s) 37, 77, 319, 534, 671
AflII CTTAAG 2 cut(s) 350, 371
AgsI TTSAA 4 cut(s) 239, 470, 740, 776
AjnI CCWGG 2 cut(s) 517, 551
AjuI GAANNNNNNNTTGG 2 cut(s) 20, 52
AluBI AGCT 6 cut(s) 36, 161, 173, 273, 436, 825
AluI AGCT 6 cut(s) 36, 161, 173, 273, 436, 825
Alw21I GWGCWC 1 cut(s) 275
Aor51HI AGCGCT 1 cut(s) 532
AoxI GGCC 3 cut(s) 289, 536, 549
ApeKI GCWGC 3 cut(s) 205, 725, 753
AscI GGCGCGCC 1 cut(s) 66
AspLEI GCGC 4 cut(s) 68, 70, 93, 533
AspS9I GGNCC 2 cut(s) 219, 289
AsuHPI GGTGA 1 cut(s) 140
AvaII GGWCC 1 cut(s) 219
BalI TGGCCA 1 cut(s) 538
BanI GGYRCC 2 cut(s) 90, 507
BanII GRGCYC 1 cut(s) 275
BbsI GAAGAC 2 cut(s) 110, 138
Bbv12I GWGCWC 1 cut(s) 275
BbvI GCAGC 3 cut(s) 192, 712, 740
BccI CCATC 3 cut(s) 325, 486, 793
BceAI ACGGC 1 cut(s) 218
BciT130I CCWGG 2 cut(s) 519, 553
BfaI CTAG 1 cut(s) 174
BfoI RGCGCY 2 cut(s) 94, 534
BfrI CTTAAG 2 cut(s) 350, 371
BisI GCNGC 4 cut(s) 71, 206, 726, 754
BlsI GCNGC 4 cut(s) 72, 207, 727, 755
Bme1390I CCNGG 2 cut(s) 519, 553
Bme18I GGWCC 1 cut(s) 219
BmgT120I GGNCC 2 cut(s) 219, 289
BmiI GGNNCC 3 cut(s) 92, 179, 509
BmrFI CCNGG 2 cut(s) 519, 553
BmsI GCATC 6 cut(s) 132, 561, 576, 606, 621, 636
BpiI GAAGAC 2 cut(s) 110, 138
BpmI CTGGAG 1 cut(s) 485
Bpu10I CCTNAGC 2 cut(s) 32, 884
BsaAI YACGTR 1 cut(s) 683
BsaHI GRCGYC 3 cut(s) 91, 150, 662
Bsc4I CCNNNNNNNGG 5 cut(s) 37, 77, 319, 534, 671
Bse3DI GCAATG 1 cut(s) 763
BseBI CCWGG 2 cut(s) 519, 553
BseGI GGATG 2 cut(s) 524, 785
BseLI CCNNNNNNNGG 5 cut(s) 37, 77, 319, 534, 671
BseMI GCAATG 1 cut(s) 763
BsePI GCGCGC 1 cut(s) 66
BseRI GAGGAG 1 cut(s) 173
BseXI GCAGC 3 cut(s) 192, 712, 740
Bsh1236I CGCG 2 cut(s) 68, 73
BshFI GGCC 3 cut(s) 291, 538, 551
BshNI GGYRCC 2 cut(s) 90, 507
BsiHKAI GWGCWC 1 cut(s) 275
BslI CCNNNNNNNGG 5 cut(s) 37, 77, 319, 534, 671
BsmI GAATGC 1 cut(s) 562
BsnI GGCC 3 cut(s) 291, 538, 551
Bsp1286I GDGCHC 1 cut(s) 275
BspACI CCGC 8 cut(s) 71, 307, 579, 594, 609, 624, 639, 654
BspANI GGCC 3 cut(s) 291, 538, 551
BspFNI CGCG 2 cut(s) 68, 73
BspLI GGNNCC 3 cut(s) 92, 179, 509
BspT107I GGYRCC 2 cut(s) 90, 507
BspTI CTTAAG 2 cut(s) 350, 371
BsrBI CCGCTC 6 cut(s) 309, 581, 596, 611, 641, 656
BsrDI GCAATG 1 cut(s) 763
BssHII GCGCGC 1 cut(s) 66
BssNI GRCGYC 3 cut(s) 91, 150, 662
Bst2UI CCWGG 2 cut(s) 519, 553
Bst4CI ACNGT 3 cut(s) 56, 116, 219
Bst6I CTCTTC 2 cut(s) 422, 698
BstACI GRCGYC 3 cut(s) 91, 150, 662
BstAFI CTTAAG 2 cut(s) 350, 371
BstBAI YACGTR 1 cut(s) 683
BstC8I GCNNGC 6 cut(s) 68, 271, 299, 303, 307, 402
BstDEI CTNAG 3 cut(s) 32, 254, 884
BstF5I GGATG 2 cut(s) 524, 785
BstFNI CGCG 2 cut(s) 68, 73
BstH2I RGCGCY 2 cut(s) 94, 534
BstHHI GCGC 4 cut(s) 68, 70, 93, 533
BstMWI GCNNNNNNNGC 4 cut(s) 158, 528, 557, 885
BstNI CCWGG 2 cut(s) 519, 553
BstNSI RCATGY 4 cut(s) 10, 398, 722, 750
BstSCI CCNGG 2 cut(s) 517, 551
BstUI CGCG 2 cut(s) 68, 73
BstV1I GCAGC 3 cut(s) 192, 712, 740
BstV2I GAAGAC 2 cut(s) 110, 138
BsuRI GGCC 3 cut(s) 291, 538, 551
BtsCI GGATG 2 cut(s) 524, 785
BtsIMutI CAGTG 2 cut(s) 61, 269
Cac8I GCNNGC 6 cut(s) 68, 271, 299, 303, 307, 402
CfoI GCGC 4 cut(s) 68, 70, 93, 533
Cfr13I GGNCC 2 cut(s) 219, 289
CpoI CGGWCCG 1 cut(s) 219
CseI GACGC 3 cut(s) 62, 158, 670
Csp6I GTAC 1 cut(s) 376
CspI CGGWCCG 1 cut(s) 219
CviAII CATG 5 cut(s) 7, 286, 395, 719, 747
CviQI GTAC 1 cut(s) 376
DdeI CTNAG 3 cut(s) 32, 254, 884
DinI GGCGCC 1 cut(s) 92
EaeI YGGCCR 1 cut(s) 536
Eam1104I CTCTTC 2 cut(s) 422, 698
EarI CTCTTC 2 cut(s) 422, 698
Ecl136II GAGCTC 1 cut(s) 273
Eco147I AGGCCT 1 cut(s) 551
Eco24I GRGCYC 1 cut(s) 275
Eco47I GGWCC 1 cut(s) 219
Eco47III AGCGCT 1 cut(s) 532
Eco53kI GAGCTC 1 cut(s) 273
Eco57I CTGAAG 1 cut(s) 477
EcoICRI GAGCTC 1 cut(s) 273
EcoRII CCWGG 2 cut(s) 517, 551
EcoT38I GRGCYC 1 cut(s) 275
EgeI GGCGCC 1 cut(s) 92
EheI GGCGCC 1 cut(s) 92
FaeI CATG 5 cut(s) 10, 289, 398, 722, 750
FatI CATG 5 cut(s) 6, 285, 394, 718, 746
FauI CCCGC 2 cut(s) 314, 586
FauNDI CATATG 1 cut(s) 891
Fnu4HI GCNGC 4 cut(s) 71, 206, 726, 754
FokI GGATG 2 cut(s) 511, 772
FriOI GRGCYC 1 cut(s) 275
Fsp4HI GCNGC 4 cut(s) 71, 206, 726, 754
FspBI CTAG 1 cut(s) 174
GlaI GCGC 4 cut(s) 67, 69, 92, 532
GluI GCNGC 4 cut(s) 71, 206, 726, 754
GsuI CTGGAG 1 cut(s) 485
HaeII RGCGCY 2 cut(s) 94, 534
HaeIII GGCC 3 cut(s) 291, 538, 551
HgaI GACGC 3 cut(s) 62, 158, 670
HhaI GCGC 4 cut(s) 68, 70, 93, 533
Hin1I GRCGYC 3 cut(s) 91, 150, 662
Hin1II CATG 5 cut(s) 10, 289, 398, 722, 750
Hin6I GCGC 4 cut(s) 66, 68, 91, 531
HinP1I GCGC 4 cut(s) 66, 68, 91, 531
HindIII AAGCTT 1 cut(s) 434
HinfI GANTC 7 cut(s) 134, 242, 323, 361, 452, 466, 768
HphI GGTGA 1 cut(s) 140
Hpy166II GTNNAC 2 cut(s) 686, 710
Hpy188I TCNGA 8 cut(s) 223, 457, 465, 585, 600, 615, 645, 660
Hpy188III TCNNGA 3 cut(s) 213, 239, 502
Hpy8I GTNNAC 2 cut(s) 686, 710
Hpy99I CGWCG 2 cut(s) 421, 664
HpyAV CCTTC 7 cut(s) 105, 452, 600, 630, 645, 660, 782
HpyCH4III ACNGT 3 cut(s) 56, 116, 219
HpyCH4IV ACGT 2 cut(s) 84, 682
HpyF10VI GCNNNNNNNGC 4 cut(s) 158, 528, 557, 885
HpyF3I CTNAG 3 cut(s) 32, 254, 884
HpySE526I ACGT 2 cut(s) 84, 682
Hsp92I GRCGYC 3 cut(s) 91, 150, 662
Hsp92II CATG 5 cut(s) 10, 289, 398, 722, 750
HspAI GCGC 4 cut(s) 66, 68, 91, 531
KasI GGCGCC 1 cut(s) 90
LmnI GCTCC 9 cut(s) 314, 586, 601, 616, 646, 661, 817, 854, 864
Lsp1109I GCAGC 3 cut(s) 192, 712, 740
LweI GCATC 6 cut(s) 132, 561, 576, 606, 621, 636
MaeI CTAG 1 cut(s) 174
MaeII ACGT 2 cut(s) 84, 682
MaeIII GTNAC 1 cut(s) 80
MbiI CCGCTC 6 cut(s) 309, 581, 596, 611, 641, 656
MboII GAAGA 6 cut(s) 99, 110, 143, 439, 558, 715
MhlI GDGCHC 1 cut(s) 275
MlsI TGGCCA 1 cut(s) 538
MluCI AATT 4 cut(s) 41, 540, 776, 842
MluNI TGGCCA 1 cut(s) 538
Mly113I GGCGCC 1 cut(s) 91
MlyI GAGTC 2 cut(s) 128, 461
MmeI TCCRAC 3 cut(s) 306, 443, 683
Mox20I TGGCCA 1 cut(s) 538
MscI TGGCCA 1 cut(s) 538
MseI TTAA 5 cut(s) 51, 351, 372, 438, 920
MslI CAYNNNNRTG 1 cut(s) 912
Msp20I TGGCCA 1 cut(s) 538
MspCI CTTAAG 2 cut(s) 350, 371
MspR9I CCNGG 2 cut(s) 519, 553
Mva1269I GAATGC 1 cut(s) 562
MvaI CCWGG 2 cut(s) 519, 553
MvnI CGCG 2 cut(s) 68, 73
MwoI GCNNNNNNNGC 4 cut(s) 158, 528, 557, 885
NarI GGCGCC 1 cut(s) 91
NdeI CATATG 1 cut(s) 891
NlaIII CATG 5 cut(s) 10, 289, 398, 722, 750
NlaIV GGNNCC 3 cut(s) 92, 179, 509
NspI RCATGY 4 cut(s) 10, 398, 722, 750
PalAI GGCGCGCC 1 cut(s) 66
PauI GCGCGC 1 cut(s) 66
PceI AGGCCT 1 cut(s) 551
PctI GAATGC 1 cut(s) 562
PfeI GAWTC 5 cut(s) 242, 323, 361, 466, 768
PflMI CCANNNNNTGG 1 cut(s) 534
PkrI GCNGC 4 cut(s) 72, 207, 727, 755
PleI GAGTC 2 cut(s) 128, 460
PluTI GGCGCC 1 cut(s) 94
PpsI GAGTC 2 cut(s) 128, 460
Ppu21I YACGTR 1 cut(s) 683
Psp124BI GAGCTC 1 cut(s) 275
Psp6I CCWGG 2 cut(s) 517, 551
PspGI CCWGG 2 cut(s) 517, 551
PspN4I GGNNCC 3 cut(s) 92, 179, 509
PspPI GGNCC 2 cut(s) 219, 289
PteI GCGCGC 1 cut(s) 66
RsaI GTAC 1 cut(s) 377
RsaNI GTAC 1 cut(s) 376
RseI CAYNNNNRTG 1 cut(s) 912
Rsr2I CGGWCCG 1 cut(s) 219
RsrII CGGWCCG 1 cut(s) 219
SacI GAGCTC 1 cut(s) 275
SaqAI TTAA 5 cut(s) 51, 351, 372, 438, 920
SatI GCNGC 4 cut(s) 71, 206, 726, 754
Sau96I GGNCC 2 cut(s) 219, 289
SchI GAGTC 2 cut(s) 128, 461
ScrFI CCNGG 2 cut(s) 519, 553
SduI GDGCHC 1 cut(s) 275
SfaNI GCATC 6 cut(s) 132, 561, 576, 606, 621, 636
SfoI GGCGCC 1 cut(s) 92
SgsI GGCGCGCC 1 cut(s) 66
SinI GGWCC 1 cut(s) 219
SmiMI CAYNNNNRTG 1 cut(s) 912
SmlI CTYRAG 2 cut(s) 350, 371
SmoI CTYRAG 2 cut(s) 350, 371
Sse9I AATT 4 cut(s) 41, 540, 776, 842
SseBI AGGCCT 1 cut(s) 551
SsiI CCGC 8 cut(s) 71, 307, 579, 594, 609, 624, 639, 654
SspDI GGCGCC 1 cut(s) 90
SspMI CTAG 1 cut(s) 174
SstI GAGCTC 1 cut(s) 275
StuI AGGCCT 1 cut(s) 551
StyD4I CCNGG 2 cut(s) 517, 551
TaaI ACNGT 3 cut(s) 56, 116, 219
TaiI ACGT 2 cut(s) 87, 685
TaqI TCGA 3 cut(s) 26, 569, 629
TasI AATT 4 cut(s) 41, 540, 776, 842
TauI GCSGC 1 cut(s) 73
TfiI GAWTC 5 cut(s) 242, 323, 361, 466, 768
Tru1I TTAA 5 cut(s) 51, 351, 372, 438, 920
Tru9I TTAA 5 cut(s) 51, 351, 372, 438, 920
TscAI CASTG 2 cut(s) 61, 269
TseI GCWGC 3 cut(s) 205, 725, 753
TspDTI ATGAA 2 cut(s) 456, 908
TspGWI ACGGA 1 cut(s) 127
TspRI CASTG 2 cut(s) 61, 269
Van91I CCANNNNNTGG 1 cut(s) 534
Vha464I CTTAAG 2 cut(s) 350, 371
VpaK11BI GGWCC 1 cut(s) 219
XceI RCATGY 4 cut(s) 10, 398, 722, 750
XspI CTAG 1 cut(s) 174
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.