Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

tig00012463

Orthogroup ID

OG0000120

Physical Location & Seq

Genomic Coordinates Forward (+)

21964 .. 32818

Gene Structure 10855 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom12463g00060.6

Sequence Viewer

CDS Protein Promoter (2k)

Length: 930 bp

ATGTGCATGTGGCTGTCAAACTCATCGAACCTTAGCTTGGAATTGAGCCTTAACAGTGATACGGGCGCGCCGCGTCAAGGTAACGTATGGCGCCCTTCTTTCTTATCTTCTAACGGTCTTCTTACAGGTGAAGACTCCGTGATGCAGGACGCCACAACAGCTACAATAGTAGCTAGGAACCTCCTCACTCCAAAAGATAGTAGGCTGCTGTCAGGACGGTCCGATGAGTTAGCCGTTCAAGAATCCCTCGCTCTTAGTGTTCAGTGTGCGAGCTCTGTGTCCAACATGGGCCAACGCCTGCTTGCCCGCTCCCGTCAGGTGGAATCATTGATGGCAGAGGTGGAAAGTCTTAAGCAAGAGATTCAGCAACTTAAGTACGAGAATAGAAGTTTGCATGTGCTTGCAAATAACTATTCGTCGGGCAGGAAGAGGAAGCTTAATGAACTGCAAGAGTCTGAAGGTCGGATTCAAAGCGACCATCAAAGGTTTTCTGCTTATCTCCAGAGGCACCTTTTTCCTGGCTCATCCAGCGCTTGGCCAATTATTGAGGCCTGGAATGCTCTATCTTCGATGCCTCCCGCTCCGATGCCTTCCGCTCCGATGTATTCCGCTCCGATGCCTTCCGCTTCGATGCCTTCCGCTCCGATGCCTTCCGCTCCGACGCCTCATAGTGGGGCTTCACGTAAACAACCTTTTTTATGGAAGAGTGAACAAGTGCATGTGGCTGCATTGTGGATTGAATGTGCATGTGGCTGCAATGGATTAGGAATCCTTCAATTTCGTCCATCCTCTTGTTCGTCCATTCCTTTTGCTCCAAGCATAAGCTATCCATTCCAAGCCCAATTTTGCTCCAAAATGCTCCAAAATGCACCTTTTTGCTTCCTTAGCCATATGAACCTAAAAACACACGAAAATGGCTTAAACTACTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004177 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005829 GO:0006508 GO:0006807 GO:0008150 GO:0008152 GO:0008233 GO:0008238 GO:0008239 GO:0016787 GO:0019538 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044238 GO:0044424 GO:0044444 GO:0044464 GO:0070011 GO:0071704 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

NUDIX Peptidase_M49

Protein Analysis

310

Amino Acids

33.96

Weight (kDa)

8.42

Isoelectric Point (pI)

70.01

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000120)

Species	Orthologous Gene IDs
malus_domestica	MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica	Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis	pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	2 cut(s)	90, 507
AccB7I	CCANNNNNTGG	1 cut(s)	534
AccBSI	CCGCTC	6 cut(s)	309, 581, 596, 611, 641, 656
AccII	CGCG	2 cut(s)	68, 73
AciI	CCGC	8 cut(s)	71, 307, 579, 594, 609, 624, 639, 654
AcoI	YGGCCR	1 cut(s)	536
AcuI	CTGAAG	1 cut(s)	477
AcyI	GRCGYC	3 cut(s)	91, 150, 662
AfaI	GTAC	1 cut(s)	377
AfeI	AGCGCT	1 cut(s)	532
AfiI	CCNNNNNNNGG	5 cut(s)	37, 77, 319, 534, 671
AflII	CTTAAG	2 cut(s)	350, 371
AgsI	TTSAA	4 cut(s)	239, 470, 740, 776
AjnI	CCWGG	2 cut(s)	517, 551
AjuI	GAANNNNNNNTTGG	2 cut(s)	20, 52
AluBI	AGCT	6 cut(s)	36, 161, 173, 273, 436, 825
AluI	AGCT	6 cut(s)	36, 161, 173, 273, 436, 825
Alw21I	GWGCWC	1 cut(s)	275
Aor51HI	AGCGCT	1 cut(s)	532
AoxI	GGCC	3 cut(s)	289, 536, 549
ApeKI	GCWGC	3 cut(s)	205, 725, 753
AscI	GGCGCGCC	1 cut(s)	66
AspLEI	GCGC	4 cut(s)	68, 70, 93, 533
AspS9I	GGNCC	2 cut(s)	219, 289
AsuHPI	GGTGA	1 cut(s)	140
AvaII	GGWCC	1 cut(s)	219
BalI	TGGCCA	1 cut(s)	538
BanI	GGYRCC	2 cut(s)	90, 507
BanII	GRGCYC	1 cut(s)	275
BbsI	GAAGAC	2 cut(s)	110, 138
Bbv12I	GWGCWC	1 cut(s)	275
BbvI	GCAGC	3 cut(s)	192, 712, 740
BccI	CCATC	3 cut(s)	325, 486, 793
BceAI	ACGGC	1 cut(s)	218
BciT130I	CCWGG	2 cut(s)	519, 553
BfaI	CTAG	1 cut(s)	174
BfoI	RGCGCY	2 cut(s)	94, 534
BfrI	CTTAAG	2 cut(s)	350, 371
BisI	GCNGC	4 cut(s)	71, 206, 726, 754
BlsI	GCNGC	4 cut(s)	72, 207, 727, 755
Bme1390I	CCNGG	2 cut(s)	519, 553
Bme18I	GGWCC	1 cut(s)	219
BmgT120I	GGNCC	2 cut(s)	219, 289
BmiI	GGNNCC	3 cut(s)	92, 179, 509
BmrFI	CCNGG	2 cut(s)	519, 553
BmsI	GCATC	6 cut(s)	132, 561, 576, 606, 621, 636
BpiI	GAAGAC	2 cut(s)	110, 138
BpmI	CTGGAG	1 cut(s)	485
Bpu10I	CCTNAGC	2 cut(s)	32, 884
BsaAI	YACGTR	1 cut(s)	683
BsaHI	GRCGYC	3 cut(s)	91, 150, 662
Bsc4I	CCNNNNNNNGG	5 cut(s)	37, 77, 319, 534, 671
Bse3DI	GCAATG	1 cut(s)	763
BseBI	CCWGG	2 cut(s)	519, 553
BseGI	GGATG	2 cut(s)	524, 785
BseLI	CCNNNNNNNGG	5 cut(s)	37, 77, 319, 534, 671
BseMI	GCAATG	1 cut(s)	763
BsePI	GCGCGC	1 cut(s)	66
BseRI	GAGGAG	1 cut(s)	173
BseXI	GCAGC	3 cut(s)	192, 712, 740
Bsh1236I	CGCG	2 cut(s)	68, 73
BshFI	GGCC	3 cut(s)	291, 538, 551
BshNI	GGYRCC	2 cut(s)	90, 507
BsiHKAI	GWGCWC	1 cut(s)	275
BslI	CCNNNNNNNGG	5 cut(s)	37, 77, 319, 534, 671
BsmI	GAATGC	1 cut(s)	562
BsnI	GGCC	3 cut(s)	291, 538, 551
Bsp1286I	GDGCHC	1 cut(s)	275
BspACI	CCGC	8 cut(s)	71, 307, 579, 594, 609, 624, 639, 654
BspANI	GGCC	3 cut(s)	291, 538, 551
BspFNI	CGCG	2 cut(s)	68, 73
BspLI	GGNNCC	3 cut(s)	92, 179, 509
BspT107I	GGYRCC	2 cut(s)	90, 507
BspTI	CTTAAG	2 cut(s)	350, 371
BsrBI	CCGCTC	6 cut(s)	309, 581, 596, 611, 641, 656
BsrDI	GCAATG	1 cut(s)	763
BssHII	GCGCGC	1 cut(s)	66
BssNI	GRCGYC	3 cut(s)	91, 150, 662
Bst2UI	CCWGG	2 cut(s)	519, 553
Bst4CI	ACNGT	3 cut(s)	56, 116, 219
Bst6I	CTCTTC	2 cut(s)	422, 698
BstACI	GRCGYC	3 cut(s)	91, 150, 662
BstAFI	CTTAAG	2 cut(s)	350, 371
BstBAI	YACGTR	1 cut(s)	683
BstC8I	GCNNGC	6 cut(s)	68, 271, 299, 303, 307, 402
BstDEI	CTNAG	3 cut(s)	32, 254, 884
BstF5I	GGATG	2 cut(s)	524, 785
BstFNI	CGCG	2 cut(s)	68, 73
BstH2I	RGCGCY	2 cut(s)	94, 534
BstHHI	GCGC	4 cut(s)	68, 70, 93, 533
BstMWI	GCNNNNNNNGC	4 cut(s)	158, 528, 557, 885
BstNI	CCWGG	2 cut(s)	519, 553
BstNSI	RCATGY	4 cut(s)	10, 398, 722, 750
BstSCI	CCNGG	2 cut(s)	517, 551
BstUI	CGCG	2 cut(s)	68, 73
BstV1I	GCAGC	3 cut(s)	192, 712, 740
BstV2I	GAAGAC	2 cut(s)	110, 138
BsuRI	GGCC	3 cut(s)	291, 538, 551
BtsCI	GGATG	2 cut(s)	524, 785
BtsIMutI	CAGTG	2 cut(s)	61, 269
Cac8I	GCNNGC	6 cut(s)	68, 271, 299, 303, 307, 402
CfoI	GCGC	4 cut(s)	68, 70, 93, 533
Cfr13I	GGNCC	2 cut(s)	219, 289
CpoI	CGGWCCG	1 cut(s)	219
CseI	GACGC	3 cut(s)	62, 158, 670
Csp6I	GTAC	1 cut(s)	376
CspI	CGGWCCG	1 cut(s)	219
CviAII	CATG	5 cut(s)	7, 286, 395, 719, 747
CviQI	GTAC	1 cut(s)	376
DdeI	CTNAG	3 cut(s)	32, 254, 884
DinI	GGCGCC	1 cut(s)	92
EaeI	YGGCCR	1 cut(s)	536
Eam1104I	CTCTTC	2 cut(s)	422, 698
EarI	CTCTTC	2 cut(s)	422, 698
Ecl136II	GAGCTC	1 cut(s)	273
Eco147I	AGGCCT	1 cut(s)	551
Eco24I	GRGCYC	1 cut(s)	275
Eco47I	GGWCC	1 cut(s)	219
Eco47III	AGCGCT	1 cut(s)	532
Eco53kI	GAGCTC	1 cut(s)	273
Eco57I	CTGAAG	1 cut(s)	477
EcoICRI	GAGCTC	1 cut(s)	273
EcoRII	CCWGG	2 cut(s)	517, 551
EcoT38I	GRGCYC	1 cut(s)	275
EgeI	GGCGCC	1 cut(s)	92
EheI	GGCGCC	1 cut(s)	92
FaeI	CATG	5 cut(s)	10, 289, 398, 722, 750
FatI	CATG	5 cut(s)	6, 285, 394, 718, 746
FauI	CCCGC	2 cut(s)	314, 586
FauNDI	CATATG	1 cut(s)	891
Fnu4HI	GCNGC	4 cut(s)	71, 206, 726, 754
FokI	GGATG	2 cut(s)	511, 772
FriOI	GRGCYC	1 cut(s)	275
Fsp4HI	GCNGC	4 cut(s)	71, 206, 726, 754
FspBI	CTAG	1 cut(s)	174
GlaI	GCGC	4 cut(s)	67, 69, 92, 532
GluI	GCNGC	4 cut(s)	71, 206, 726, 754
GsuI	CTGGAG	1 cut(s)	485
HaeII	RGCGCY	2 cut(s)	94, 534
HaeIII	GGCC	3 cut(s)	291, 538, 551
HgaI	GACGC	3 cut(s)	62, 158, 670
HhaI	GCGC	4 cut(s)	68, 70, 93, 533
Hin1I	GRCGYC	3 cut(s)	91, 150, 662
Hin1II	CATG	5 cut(s)	10, 289, 398, 722, 750
Hin6I	GCGC	4 cut(s)	66, 68, 91, 531
HinP1I	GCGC	4 cut(s)	66, 68, 91, 531
HindIII	AAGCTT	1 cut(s)	434
HinfI	GANTC	7 cut(s)	134, 242, 323, 361, 452, 466, 768
HphI	GGTGA	1 cut(s)	140
Hpy166II	GTNNAC	2 cut(s)	686, 710
Hpy188I	TCNGA	8 cut(s)	223, 457, 465, 585, 600, 615, 645, 660
Hpy188III	TCNNGA	3 cut(s)	213, 239, 502
Hpy8I	GTNNAC	2 cut(s)	686, 710
Hpy99I	CGWCG	2 cut(s)	421, 664
HpyAV	CCTTC	7 cut(s)	105, 452, 600, 630, 645, 660, 782
HpyCH4III	ACNGT	3 cut(s)	56, 116, 219
HpyCH4IV	ACGT	2 cut(s)	84, 682
HpyF10VI	GCNNNNNNNGC	4 cut(s)	158, 528, 557, 885
HpyF3I	CTNAG	3 cut(s)	32, 254, 884
HpySE526I	ACGT	2 cut(s)	84, 682
Hsp92I	GRCGYC	3 cut(s)	91, 150, 662
Hsp92II	CATG	5 cut(s)	10, 289, 398, 722, 750
HspAI	GCGC	4 cut(s)	66, 68, 91, 531
KasI	GGCGCC	1 cut(s)	90
LmnI	GCTCC	9 cut(s)	314, 586, 601, 616, 646, 661, 817, 854, 864
Lsp1109I	GCAGC	3 cut(s)	192, 712, 740
LweI	GCATC	6 cut(s)	132, 561, 576, 606, 621, 636
MaeI	CTAG	1 cut(s)	174
MaeII	ACGT	2 cut(s)	84, 682
MaeIII	GTNAC	1 cut(s)	80
MbiI	CCGCTC	6 cut(s)	309, 581, 596, 611, 641, 656
MboII	GAAGA	6 cut(s)	99, 110, 143, 439, 558, 715
MhlI	GDGCHC	1 cut(s)	275
MlsI	TGGCCA	1 cut(s)	538
MluCI	AATT	4 cut(s)	41, 540, 776, 842
MluNI	TGGCCA	1 cut(s)	538
Mly113I	GGCGCC	1 cut(s)	91
MlyI	GAGTC	2 cut(s)	128, 461
MmeI	TCCRAC	3 cut(s)	306, 443, 683
Mox20I	TGGCCA	1 cut(s)	538
MscI	TGGCCA	1 cut(s)	538
MseI	TTAA	5 cut(s)	51, 351, 372, 438, 920
MslI	CAYNNNNRTG	1 cut(s)	912
Msp20I	TGGCCA	1 cut(s)	538
MspCI	CTTAAG	2 cut(s)	350, 371
MspR9I	CCNGG	2 cut(s)	519, 553
Mva1269I	GAATGC	1 cut(s)	562
MvaI	CCWGG	2 cut(s)	519, 553
MvnI	CGCG	2 cut(s)	68, 73
MwoI	GCNNNNNNNGC	4 cut(s)	158, 528, 557, 885
NarI	GGCGCC	1 cut(s)	91
NdeI	CATATG	1 cut(s)	891
NlaIII	CATG	5 cut(s)	10, 289, 398, 722, 750
NlaIV	GGNNCC	3 cut(s)	92, 179, 509
NspI	RCATGY	4 cut(s)	10, 398, 722, 750
PalAI	GGCGCGCC	1 cut(s)	66
PauI	GCGCGC	1 cut(s)	66
PceI	AGGCCT	1 cut(s)	551
PctI	GAATGC	1 cut(s)	562
PfeI	GAWTC	5 cut(s)	242, 323, 361, 466, 768
PflMI	CCANNNNNTGG	1 cut(s)	534
PkrI	GCNGC	4 cut(s)	72, 207, 727, 755
PleI	GAGTC	2 cut(s)	128, 460
PluTI	GGCGCC	1 cut(s)	94
PpsI	GAGTC	2 cut(s)	128, 460
Ppu21I	YACGTR	1 cut(s)	683
Psp124BI	GAGCTC	1 cut(s)	275
Psp6I	CCWGG	2 cut(s)	517, 551
PspGI	CCWGG	2 cut(s)	517, 551
PspN4I	GGNNCC	3 cut(s)	92, 179, 509
PspPI	GGNCC	2 cut(s)	219, 289
PteI	GCGCGC	1 cut(s)	66
RsaI	GTAC	1 cut(s)	377
RsaNI	GTAC	1 cut(s)	376
RseI	CAYNNNNRTG	1 cut(s)	912
Rsr2I	CGGWCCG	1 cut(s)	219
RsrII	CGGWCCG	1 cut(s)	219
SacI	GAGCTC	1 cut(s)	275
SaqAI	TTAA	5 cut(s)	51, 351, 372, 438, 920
SatI	GCNGC	4 cut(s)	71, 206, 726, 754
Sau96I	GGNCC	2 cut(s)	219, 289
SchI	GAGTC	2 cut(s)	128, 461
ScrFI	CCNGG	2 cut(s)	519, 553
SduI	GDGCHC	1 cut(s)	275
SfaNI	GCATC	6 cut(s)	132, 561, 576, 606, 621, 636
SfoI	GGCGCC	1 cut(s)	92
SgsI	GGCGCGCC	1 cut(s)	66
SinI	GGWCC	1 cut(s)	219
SmiMI	CAYNNNNRTG	1 cut(s)	912
SmlI	CTYRAG	2 cut(s)	350, 371
SmoI	CTYRAG	2 cut(s)	350, 371
Sse9I	AATT	4 cut(s)	41, 540, 776, 842
SseBI	AGGCCT	1 cut(s)	551
SsiI	CCGC	8 cut(s)	71, 307, 579, 594, 609, 624, 639, 654
SspDI	GGCGCC	1 cut(s)	90
SspMI	CTAG	1 cut(s)	174
SstI	GAGCTC	1 cut(s)	275
StuI	AGGCCT	1 cut(s)	551
StyD4I	CCNGG	2 cut(s)	517, 551
TaaI	ACNGT	3 cut(s)	56, 116, 219
TaiI	ACGT	2 cut(s)	87, 685
TaqI	TCGA	3 cut(s)	26, 569, 629
TasI	AATT	4 cut(s)	41, 540, 776, 842
TauI	GCSGC	1 cut(s)	73
TfiI	GAWTC	5 cut(s)	242, 323, 361, 466, 768
Tru1I	TTAA	5 cut(s)	51, 351, 372, 438, 920
Tru9I	TTAA	5 cut(s)	51, 351, 372, 438, 920
TscAI	CASTG	2 cut(s)	61, 269
TseI	GCWGC	3 cut(s)	205, 725, 753
TspDTI	ATGAA	2 cut(s)	456, 908
TspGWI	ACGGA	1 cut(s)	127
TspRI	CASTG	2 cut(s)	61, 269
Van91I	CCANNNNNTGG	1 cut(s)	534
Vha464I	CTTAAG	2 cut(s)	350, 371
VpaK11BI	GGWCC	1 cut(s)	219
XceI	RCATGY	4 cut(s)	10, 398, 722, 750
XspI	CTAG	1 cut(s)	174

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.