pycom04g09780

Nudix hydrolase 3-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr4
Physical Location & Seq
Reverse (-)
12522732 .. 12523049
318 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom04g09780.1

Sequence Viewer

Length: 318 bp
ATGCTCGCACATAGCTATGCTACAACCATGAAGAGAAAGCTTGACCAGTTACAGGAATCCGAAGGTCAGATTTTAAATGATCATCAGAGGTTTGTGAGTTTGTTCGAAAGGCATTTACTGCCTTCGTCCTCTGGGGCTGTACCACATATTGAAGCTCCAAATGATCAACCTCTGGTGCCTCCTCTTTCTGGGGTTCTGCCCAGTACTGAGGCTCCAAATAATCACCCTCCGGTGCCTCCTATTTCTGGGGCTTTGCCGAATGTTGAGACTTATCCTGAGCAACCTTTGTGGAGGCGCCCTCCTGTTTGTTTGTTTTGA

Protein Analysis

106

Amino Acids

11.65

Weight (kDa)

5.88

Isoelectric Point (pI)

86.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 3 cut(s) 175, 232, 294
AcyI GRCGYC 1 cut(s) 295
AfaI GTAC 2 cut(s) 141, 205
AfiI CCNNNNNNNGG 3 cut(s) 52, 188, 245
AgsI TTSAA 1 cut(s) 152
AluBI AGCT 3 cut(s) 15, 40, 155
AluI AGCT 3 cut(s) 15, 40, 155
Alw26I GTCTC 1 cut(s) 260
AspLEI GCGC 1 cut(s) 297
AsuHPI GGTGA 1 cut(s) 215
AsuII TTCGAA 1 cut(s) 105
BanI GGYRCC 3 cut(s) 175, 232, 294
BclI TGATCA 2 cut(s) 79, 163
BcoDI GTCTC 1 cut(s) 260
BfoI RGCGCY 1 cut(s) 298
BmcAI AGTACT 1 cut(s) 205
BmiI GGNNCC 4 cut(s) 177, 213, 234, 296
BmrI ACTGGG 1 cut(s) 195
BmuI ACTGGG 1 cut(s) 195
BplI GAGNNNNNCTC 2 cut(s) 283, 315
Bpu10I CCTNAGC 1 cut(s) 276
Bpu14I TTCGAA 1 cut(s) 105
BsaHI GRCGYC 1 cut(s) 295
BsaWI WCCGGW 1 cut(s) 229
BsaXI ACNNNNNCTCC 2 cut(s) 196, 226
Bsc4I CCNNNNNNNGG 3 cut(s) 52, 188, 245
Bse1I ACTGG 2 cut(s) 46, 201
BseLI CCNNNNNNNGG 3 cut(s) 52, 188, 245
BseMII CTCAG 2 cut(s) 198, 267
BseNI ACTGG 2 cut(s) 46, 201
BseRI GAGGAG 1 cut(s) 171
BshNI GGYRCC 3 cut(s) 175, 232, 294
BsiSI CCGG 1 cut(s) 230
BslI CCNNNNNNNGG 3 cut(s) 52, 188, 245
BsmAI GTCTC 1 cut(s) 260
Bsp119I TTCGAA 1 cut(s) 105
Bsp143I GATC 2 cut(s) 79, 163
BspCNI CTCAG 2 cut(s) 199, 268
BspLI GGNNCC 4 cut(s) 177, 213, 234, 296
BspT104I TTCGAA 1 cut(s) 105
BspT107I GGYRCC 3 cut(s) 175, 232, 294
BsrI ACTGG 2 cut(s) 46, 201
BssMI GATC 2 cut(s) 79, 163
BssNI GRCGYC 1 cut(s) 295
Bst6I CTCTTC 1 cut(s) 26
BstACI GRCGYC 1 cut(s) 295
BstAPI GCANNNNNTGC 1 cut(s) 118
BstBI TTCGAA 1 cut(s) 105
BstC8I GCNNGC 1 cut(s) 6
BstDEI CTNAG 2 cut(s) 207, 276
BstH2I RGCGCY 1 cut(s) 298
BstHHI GCGC 1 cut(s) 297
BstKTI GATC 2 cut(s) 82, 166
BstMAI GTCTC 1 cut(s) 260
BstMBI GATC 2 cut(s) 79, 163
BstMWI GCNNNNNNNGC 1 cut(s) 118
Cac8I GCNNGC 1 cut(s) 6
CfoI GCGC 1 cut(s) 297
Csp6I GTAC 2 cut(s) 140, 204
CspCI CAANNNNNGTGG 2 cut(s) 269, 304
CviAII CATG 1 cut(s) 28
CviJI RGCY 6 cut(s) 15, 40, 137, 155, 212, 251
CviKI_1 RGCY 6 cut(s) 15, 40, 137, 155, 212, 251
CviQI GTAC 2 cut(s) 140, 204
DdeI CTNAG 2 cut(s) 207, 276
DinI GGCGCC 1 cut(s) 296
DpnI GATC 2 cut(s) 81, 165
DpnII GATC 2 cut(s) 79, 163
DraI TTTAAA 1 cut(s) 75
Eam1104I CTCTTC 1 cut(s) 26
EarI CTCTTC 1 cut(s) 26
EgeI GGCGCC 1 cut(s) 296
EheI GGCGCC 1 cut(s) 296
FaeI CATG 1 cut(s) 31
FaiI YATR 4 cut(s) 12, 18, 29, 147
FatI CATG 1 cut(s) 27
FbaI TGATCA 2 cut(s) 79, 163
GlaI GCGC 1 cut(s) 296
HaeII RGCGCY 1 cut(s) 298
HapII CCGG 1 cut(s) 230
HhaI GCGC 1 cut(s) 297
Hin1I GRCGYC 1 cut(s) 295
Hin1II CATG 1 cut(s) 31
Hin6I GCGC 1 cut(s) 295
HinP1I GCGC 1 cut(s) 295
HindIII AAGCTT 1 cut(s) 38
HinfI GANTC 1 cut(s) 56
HpaII CCGG 1 cut(s) 230
HphI GGTGA 1 cut(s) 215
Hpy188I TCNGA 3 cut(s) 61, 69, 87
Hpy188III TCNNGA 1 cut(s) 275
HpyAV CCTTC 2 cut(s) 56, 132
HpyF10VI GCNNNNNNNGC 1 cut(s) 118
HpyF3I CTNAG 2 cut(s) 207, 276
Hsp92I GRCGYC 1 cut(s) 295
Hsp92II CATG 1 cut(s) 31
HspAI GCGC 1 cut(s) 295
KasI GGCGCC 1 cut(s) 294
Ksp22I TGATCA 2 cut(s) 79, 163
Kzo9I GATC 2 cut(s) 79, 163
LmnI GCTCC 2 cut(s) 160, 217
LpnPI CCDG 9 cut(s) 38, 59, 117, 158, 174, 214, 231, 243, 288
MaeIII GTNAC 1 cut(s) 48
MalI GATC 2 cut(s) 81, 165
MboI GATC 2 cut(s) 79, 163
MboII GAAGA 1 cut(s) 43
Mly113I GGCGCC 1 cut(s) 295
MseI TTAA 1 cut(s) 74
MslI CAYNNNNRTG 1 cut(s) 15
MspI CCGG 1 cut(s) 230
MwoI GCNNNNNNNGC 1 cut(s) 118
NarI GGCGCC 1 cut(s) 295
NdeII GATC 2 cut(s) 79, 163
NlaIII CATG 1 cut(s) 31
NlaIV GGNNCC 4 cut(s) 177, 213, 234, 296
NspV TTCGAA 1 cut(s) 105
PfeI GAWTC 1 cut(s) 56
PluTI GGCGCC 1 cut(s) 298
PspN4I GGNNCC 4 cut(s) 177, 213, 234, 296
RsaI GTAC 2 cut(s) 141, 205
RsaNI GTAC 2 cut(s) 140, 204
RseI CAYNNNNRTG 1 cut(s) 15
SaqAI TTAA 1 cut(s) 74
Sau3AI GATC 2 cut(s) 79, 163
ScaI AGTACT 1 cut(s) 205
SetI ASST 7 cut(s) 17, 42, 67, 92, 157, 172, 286
SfoI GGCGCC 1 cut(s) 296
SfuI TTCGAA 1 cut(s) 105
SmiMI CAYNNNNRTG 1 cut(s) 15
SspDI GGCGCC 1 cut(s) 294
TaqI TCGA 1 cut(s) 105
TatI WGTACW 1 cut(s) 203
TfiI GAWTC 1 cut(s) 56
Tru1I TTAA 1 cut(s) 74
Tru9I TTAA 1 cut(s) 74
TspDTI ATGAA 1 cut(s) 44
ZrmI AGTACT 1 cut(s) 205
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.