Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr16

Orthogroup ID

OG0000120

Physical Location & Seq

Genomic Coordinates Forward (+)

26763390 .. 26770430

Gene Structure 7041 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom16g25040.4

Sequence Viewer

CDS Protein Promoter (2k)

Length: 816 bp

ATGGTGGAATGGGGACTCACGGTTTTGGATTCTAAGGGGAATATGGGAAGTAAGGCAAACTCATCGAACCTTAGCTTAGATTTGAGTCTCAGCAGCGATCCGGTTGCGCCCCGTCAAGGTAATGTATGGCGCCCTTCTTTTTTATCTTCTAACGGTCATCTTTCAGGTGAAGACTCTGTGATGCAGGACGCCACAACAGCTACAATAGTAGCTAAAAACCTCCTCACTCCAAAAGATAGTAGGCTGCTGTCAGGACGATCCGATGAGTTGGCCGTTCAAGAGTCCCTCGCACTTAGTGTTCAGTGTGCGAGTTCTGTGTCCAACATGGGCCAACGCCTGCTTGCCCGCTCCCGTCAGGTGGAATCATTGATGGCAGAGGTGGAAAGTCTCAAGCAGGAGATCAAACTGCTTAAGTACGAGAATAGAAGTTTGCACGTGCTTGCCAACAACTATTCGACGGGTATGAAGAGGAAGCTTGATGAGCTACAAGAATCCAATGGTCGGATGCAAAGTGACCGTCAAACTGACCGTCAAAGGCTTGCGGCTTACTTCCAGAGGCACATTTTTCCGGGCTCATCCAGCGTTTGGCCAAGTATTGAGGCCTCTTCTTTGATGCCTCCCGCTCCGATACCTTCCGCCCCGATGCCTTCCGCCTCGATGCCTTCTGCTCCGATGCCTTCCGCATCTATGCCTCCTGCTTCTAGAGTTTTGCCCAGTAGTGGGGCTTCAAGTAAACGCCCTTTGTTTGGGGGATTATGGAAATGGATGAGGAATGTTGTGGTGTGTGAAATGGAGAGATCTTTCATGAATGAATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004177 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005829 GO:0006508 GO:0006807 GO:0008150 GO:0008152 GO:0008233 GO:0008238 GO:0008239 GO:0016787 GO:0019538 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044238 GO:0044424 GO:0044444 GO:0044464 GO:0070011 GO:0071704 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

NUDIX Peptidase_M49

Protein Analysis

272

Amino Acids

29.59

Weight (kDa)

9.17

Isoelectric Point (pI)

63.61

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000120)

Species	Orthologous Gene IDs
malus_domestica	MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica	Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis	pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	129
AccB7I	CCANNNNNTGG	1 cut(s)	585
AccBSI	CCGCTC	2 cut(s)	348, 623
AciI	CCGC	6 cut(s)	346, 542, 621, 636, 651, 681
AclWI	GGATC	2 cut(s)	92, 252
AcoI	YGGCCR	2 cut(s)	270, 587
AcvI	CACGTG	1 cut(s)	436
AcyI	GRCGYC	2 cut(s)	130, 189
AdeI	CACNNNGTG	1 cut(s)	296
AfaI	GTAC	1 cut(s)	416
AfiI	CCNNNNNNNGG	7 cut(s)	116, 358, 501, 585, 719, 720, 746
AflII	CTTAAG	1 cut(s)	410
AgsI	TTSAA	2 cut(s)	278, 729
AluBI	AGCT	5 cut(s)	75, 200, 212, 475, 484
AluI	AGCT	5 cut(s)	75, 200, 212, 475, 484
Alw26I	GTCTC	2 cut(s)	92, 392
AlwI	GGATC	2 cut(s)	92, 252
AoxI	GGCC	4 cut(s)	270, 328, 587, 600
ApeKI	GCWGC	2 cut(s)	93, 244
ArsI	GACNNNNNNTTYG	4 cut(s)	502, 514, 534, 546
AspLEI	GCGC	2 cut(s)	109, 132
AspS9I	GGNCC	1 cut(s)	328
AsuC2I	CCSGG	1 cut(s)	570
AsuHPI	GGTGA	1 cut(s)	179
BalI	TGGCCA	1 cut(s)	589
BanI	GGYRCC	1 cut(s)	129
BanII	GRGCYC	1 cut(s)	575
BarI	GAAGNNNNNNTAC	2 cut(s)	709, 741
BbrPI	CACGTG	1 cut(s)	436
BbsI	GAAGAC	1 cut(s)	177
BbvI	GCAGC	2 cut(s)	105, 231
BccI	CCATC	1 cut(s)	364
BceAI	ACGGC	1 cut(s)	257
BcgI	CGANNNNNNTGC	4 cut(s)	45, 79, 86, 120
BcnI	CCSGG	1 cut(s)	570
BcoDI	GTCTC	2 cut(s)	92, 392
BfaI	CTAG	1 cut(s)	702
BfoI	RGCGCY	1 cut(s)	133
BfrI	CTTAAG	1 cut(s)	410
BglII	AGATCT	1 cut(s)	797
BisI	GCNGC	3 cut(s)	94, 245, 543
BlsI	GCNGC	3 cut(s)	95, 246, 544
Bme1390I	CCNGG	1 cut(s)	570
BmgT120I	GGNCC	1 cut(s)	328
BmiI	GGNNCC	1 cut(s)	131
BmrFI	CCNGG	1 cut(s)	570
BmrI	ACTGGG	1 cut(s)	708
BmsI	GCATC	7 cut(s)	171, 495, 603, 633, 648, 663, 692
BmuI	ACTGGG	1 cut(s)	708
BpiI	GAAGAC	1 cut(s)	177
Bpu10I	CCTNAGC	1 cut(s)	71
BpuEI	CTTGAG	1 cut(s)	374
BpuMI	CCSGG	1 cut(s)	570
BsaAI	YACGTR	1 cut(s)	436
BsaHI	GRCGYC	2 cut(s)	130, 189
BsaWI	WCCGGW	1 cut(s)	100
Bsc4I	CCNNNNNNNGG	7 cut(s)	116, 358, 501, 585, 719, 720, 746
Bse1I	ACTGG	1 cut(s)	714
BseGI	GGATG	3 cut(s)	510, 575, 771
BseLI	CCNNNNNNNGG	7 cut(s)	116, 358, 501, 585, 719, 720, 746
BseMII	CTCAG	1 cut(s)	103
BseNI	ACTGG	1 cut(s)	714
BseRI	GAGGAG	1 cut(s)	212
BseXI	GCAGC	2 cut(s)	105, 231
BshFI	GGCC	4 cut(s)	272, 330, 589, 602
BshNI	GGYRCC	1 cut(s)	129
BsiSI	CCGG	2 cut(s)	101, 569
BslFI	GGGAC	2 cut(s)	27, 268
BslI	CCNNNNNNNGG	7 cut(s)	116, 358, 501, 585, 719, 720, 746
BsmAI	GTCTC	2 cut(s)	92, 392
BsmFI	GGGAC	2 cut(s)	27, 268
BsnI	GGCC	4 cut(s)	272, 330, 589, 602
Bsp1286I	GDGCHC	1 cut(s)	575
Bsp143I	GATC	4 cut(s)	97, 257, 399, 797
BspACI	CCGC	6 cut(s)	346, 542, 621, 636, 651, 681
BspANI	GGCC	4 cut(s)	272, 330, 589, 602
BspCNI	CTCAG	1 cut(s)	102
BspHI	TCATGA	1 cut(s)	804
BspLI	GGNNCC	1 cut(s)	131
BspPI	GGATC	2 cut(s)	92, 252
BspT107I	GGYRCC	1 cut(s)	129
BspTI	CTTAAG	1 cut(s)	410
BsrBI	CCGCTC	2 cut(s)	348, 623
BsrI	ACTGG	1 cut(s)	714
BssMI	GATC	4 cut(s)	97, 257, 399, 797
BssNI	GRCGYC	2 cut(s)	130, 189
Bst4CI	ACNGT	4 cut(s)	22, 155, 518, 530
Bst6I	CTCTTC	2 cut(s)	461, 610
BstACI	GRCGYC	2 cut(s)	130, 189
BstAFI	CTTAAG	1 cut(s)	410
BstBAI	YACGTR	1 cut(s)	436
BstC8I	GCNNGC	5 cut(s)	338, 342, 346, 441, 540
BstDEI	CTNAG	5 cut(s)	33, 71, 76, 89, 293
BstF5I	GGATG	3 cut(s)	510, 575, 771
BstH2I	RGCGCY	1 cut(s)	133
BstHHI	GCGC	2 cut(s)	109, 132
BstKTI	GATC	4 cut(s)	100, 260, 402, 800
BstMAI	GTCTC	2 cut(s)	92, 392
BstMBI	GATC	4 cut(s)	97, 257, 399, 797
BstMWI	GCNNNNNNNGC	3 cut(s)	197, 481, 579
BstSCI	CCNGG	1 cut(s)	568
BstV1I	GCAGC	2 cut(s)	105, 231
BstV2I	GAAGAC	1 cut(s)	177
BstX2I	RGATCY	1 cut(s)	797
BstYI	RGATCY	1 cut(s)	797
BsuRI	GGCC	4 cut(s)	272, 330, 589, 602
BtsCI	GGATG	3 cut(s)	510, 575, 771
BtsIMutI	CAGTG	1 cut(s)	308
Cac8I	GCNNGC	5 cut(s)	338, 342, 346, 441, 540
CciI	TCATGA	1 cut(s)	804
CfoI	GCGC	2 cut(s)	109, 132
Cfr13I	GGNCC	1 cut(s)	328
CseI	GACGC	1 cut(s)	197
Csp6I	GTAC	1 cut(s)	415
CviAII	CATG	2 cut(s)	325, 805
CviQI	GTAC	1 cut(s)	415
DdeI	CTNAG	5 cut(s)	33, 71, 76, 89, 293
DinI	GGCGCC	1 cut(s)	131
DpnI	GATC	4 cut(s)	99, 259, 401, 799
DpnII	GATC	4 cut(s)	97, 257, 399, 797
DraIII	CACNNNGTG	1 cut(s)	296
EaeI	YGGCCR	2 cut(s)	270, 587
Eam1104I	CTCTTC	2 cut(s)	461, 610
EarI	CTCTTC	2 cut(s)	461, 610
EciI	GGCGGA	2 cut(s)	625, 640
Eco147I	AGGCCT	1 cut(s)	602
Eco24I	GRGCYC	1 cut(s)	575
Eco72I	CACGTG	1 cut(s)	436
EcoT38I	GRGCYC	1 cut(s)	575
EgeI	GGCGCC	1 cut(s)	131
EheI	GGCGCC	1 cut(s)	131
FaeI	CATG	2 cut(s)	328, 808
FaiI	YATR	7 cut(s)	44, 127, 326, 464, 689, 757, 806
FaqI	GGGAC	2 cut(s)	27, 268
FatI	CATG	2 cut(s)	324, 804
FauI	CCCGC	2 cut(s)	353, 628
Fnu4HI	GCNGC	3 cut(s)	94, 245, 543
FokI	GGATG	3 cut(s)	517, 562, 778
FriOI	GRGCYC	1 cut(s)	575
Fsp4HI	GCNGC	3 cut(s)	94, 245, 543
FspBI	CTAG	1 cut(s)	702
GlaI	GCGC	2 cut(s)	108, 131
GluI	GCNGC	3 cut(s)	94, 245, 543
HaeII	RGCGCY	1 cut(s)	133
HaeIII	GGCC	4 cut(s)	272, 330, 589, 602
HapII	CCGG	2 cut(s)	101, 569
HgaI	GACGC	1 cut(s)	197
HhaI	GCGC	2 cut(s)	109, 132
Hin1I	GRCGYC	2 cut(s)	130, 189
Hin1II	CATG	2 cut(s)	328, 808
Hin6I	GCGC	2 cut(s)	107, 130
HinP1I	GCGC	2 cut(s)	107, 130
HindIII	AAGCTT	1 cut(s)	473
HinfI	GANTC	7 cut(s)	15, 29, 85, 173, 281, 362, 491
HpaII	CCGG	2 cut(s)	101, 569
HphI	GGTGA	1 cut(s)	179
Hpy166II	GTNNAC	1 cut(s)	734
Hpy188I	TCNGA	4 cut(s)	262, 504, 627, 672
Hpy188III	TCNNGA	5 cut(s)	252, 278, 553, 702, 805
Hpy8I	GTNNAC	1 cut(s)	734
Hpy99I	CGWCG	1 cut(s)	460
HpyAV	CCTTC	5 cut(s)	144, 642, 657, 672, 687
HpyCH4III	ACNGT	4 cut(s)	22, 155, 518, 530
HpyCH4IV	ACGT	1 cut(s)	435
HpyCH4V	TGCA	3 cut(s)	184, 433, 508
HpyF10VI	GCNNNNNNNGC	3 cut(s)	197, 481, 579
HpyF3I	CTNAG	5 cut(s)	33, 71, 76, 89, 293
HpySE526I	ACGT	1 cut(s)	435
Hsp92I	GRCGYC	2 cut(s)	130, 189
Hsp92II	CATG	2 cut(s)	328, 808
HspAI	GCGC	2 cut(s)	107, 130
KasI	GGCGCC	1 cut(s)	129
Kzo9I	GATC	4 cut(s)	97, 257, 399, 797
LmnI	GCTCC	3 cut(s)	353, 628, 673
Lsp1109I	GCAGC	2 cut(s)	105, 231
LweI	GCATC	7 cut(s)	171, 495, 603, 633, 648, 663, 692
MaeI	CTAG	1 cut(s)	702
MaeII	ACGT	1 cut(s)	435
MaeIII	GTNAC	1 cut(s)	512
MalI	GATC	4 cut(s)	99, 259, 401, 799
MbiI	CCGCTC	2 cut(s)	348, 623
MboI	GATC	4 cut(s)	97, 257, 399, 797
MboII	GAAGA	4 cut(s)	138, 182, 478, 597
MflI	RGATCY	1 cut(s)	797
MhlI	GDGCHC	1 cut(s)	575
MlsI	TGGCCA	1 cut(s)	589
MluNI	TGGCCA	1 cut(s)	589
Mly113I	GGCGCC	1 cut(s)	130
MlyI	GAGTC	4 cut(s)	9, 94, 167, 290
MmeI	TCCRAC	2 cut(s)	345, 482
Mox20I	TGGCCA	1 cut(s)	589
MscI	TGGCCA	1 cut(s)	589
MseI	TTAA	1 cut(s)	411
Msp20I	TGGCCA	1 cut(s)	589
MspCI	CTTAAG	1 cut(s)	410
MspI	CCGG	2 cut(s)	101, 569
MspR9I	CCNGG	1 cut(s)	570
MwoI	GCNNNNNNNGC	3 cut(s)	197, 481, 579
NarI	GGCGCC	1 cut(s)	130
NciI	CCSGG	1 cut(s)	570
NdeII	GATC	4 cut(s)	97, 257, 399, 797
NlaIII	CATG	2 cut(s)	328, 808
NlaIV	GGNNCC	1 cut(s)	131
NmuCI	GTSAC	1 cut(s)	512
PagI	TCATGA	1 cut(s)	804
PceI	AGGCCT	1 cut(s)	602
PfeI	GAWTC	3 cut(s)	29, 362, 491
PflMI	CCANNNNNTGG	1 cut(s)	585
PkrI	GCNGC	3 cut(s)	95, 246, 544
PleI	GAGTC	4 cut(s)	9, 93, 167, 289
PluTI	GGCGCC	1 cut(s)	133
PmaCI	CACGTG	1 cut(s)	436
PmlI	CACGTG	1 cut(s)	436
PpsI	GAGTC	4 cut(s)	9, 93, 167, 289
Ppu21I	YACGTR	1 cut(s)	436
PspCI	CACGTG	1 cut(s)	436
PspN4I	GGNNCC	1 cut(s)	131
PspPI	GGNCC	1 cut(s)	328
PsuI	RGATCY	1 cut(s)	797
RsaI	GTAC	1 cut(s)	416
RsaNI	GTAC	1 cut(s)	415
SaqAI	TTAA	1 cut(s)	411
SatI	GCNGC	3 cut(s)	94, 245, 543
Sau3AI	GATC	4 cut(s)	97, 257, 399, 797
Sau96I	GGNCC	1 cut(s)	328
SchI	GAGTC	4 cut(s)	9, 94, 167, 290
ScrFI	CCNGG	1 cut(s)	570
SduI	GDGCHC	1 cut(s)	575
SfaNI	GCATC	7 cut(s)	171, 495, 603, 633, 648, 663, 692
SfoI	GGCGCC	1 cut(s)	131
SmlI	CTYRAG	2 cut(s)	389, 410
SmoI	CTYRAG	2 cut(s)	389, 410
SseBI	AGGCCT	1 cut(s)	602
SsiI	CCGC	6 cut(s)	346, 542, 621, 636, 651, 681
SspDI	GGCGCC	1 cut(s)	129
SspMI	CTAG	1 cut(s)	702
StuI	AGGCCT	1 cut(s)	602
StyD4I	CCNGG	1 cut(s)	568
TaaI	ACNGT	4 cut(s)	22, 155, 518, 530
TaiI	ACGT	1 cut(s)	438
TaqI	TCGA	3 cut(s)	65, 455, 656
TauI	GCSGC	1 cut(s)	545
TfiI	GAWTC	3 cut(s)	29, 362, 491
Tru1I	TTAA	1 cut(s)	411
Tru9I	TTAA	1 cut(s)	411
TscAI	CASTG	1 cut(s)	308
TseFI	GTSAC	1 cut(s)	512
TseI	GCWGC	2 cut(s)	93, 244
Tsp45I	GTSAC	1 cut(s)	512
TspDTI	ATGAA	2 cut(s)	479, 793
TspRI	CASTG	1 cut(s)	308
Van91I	CCANNNNNTGG	1 cut(s)	585
Vha464I	CTTAAG	1 cut(s)	410
XbaI	TCTAGA	1 cut(s)	701
XspI	CTAG	1 cut(s)	702

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.