pycom05g09050

Nudix hydrolase 3-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr5
Physical Location & Seq
Reverse (-)
12080167 .. 12080715
549 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom05g09050.1

Sequence Viewer

Length: 549 bp
ATGCAGGACGCCACAACAGCTACAATAGTAGCTAGGAACCTCCTCACTCCGAAAGATAGTAGGCTGCTGTCAGGACGGTCCGATGAGTTGGCCGTTCAAGAGTCCCTCGCACTTAGTGTTCAGTGTGCGAGTTCTGTGTCCAACATGGGCCAACGCCTGCTTGCCCGCTCCCGTCAGGTGGAATCATTGATGGCAGAGGTGGAAAGTCTCAAGCAGGAGATCCAGCAGCTGAAGTATGAGAATAGAAGTTTGCACGTGCTTGCAAACAACTATTCGACGGGCATGAAGAGGAAGCTTGATGAGCTGCAAGAGTCTGAAGGTCGGATTCATAGTGACCGTCAAAGGTTTTCGTCTTTCCTCCAGAGGCACCTTTTTCCTGGCTCATCCAGCGCTTGGCCAAGTATTGAGGCCTGGAATGCTCTATCTTCGATGCCTCCCGCTCCGATGCCTTCTGCTCCTACGCCTTCCGCTCCGATGCCTTCTGTTCCTACGCCTTCCGCTTCAAGAGTAAAGCCACGTAGTGGGGCCTCAAGCAAACAACCTTTGTGA

Protein Analysis

183

Amino Acids

19.92

Weight (kDa)

9.72

Isoelectric Point (pI)

72.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 366
AccB7I CCANNNNNTGG 2 cut(s) 393, 521
AccBSI CCGCTC 3 cut(s) 168, 440, 470
AciI CCGC 4 cut(s) 166, 438, 468, 498
AclWI GGATC 1 cut(s) 214
AcoI YGGCCR 2 cut(s) 90, 395
AcuI CTGAAG 2 cut(s) 251, 336
AcvI CACGTG 1 cut(s) 256
AcyI GRCGYC 1 cut(s) 9
AdeI CACNNNGTG 2 cut(s) 116, 521
AfeI AGCGCT 1 cut(s) 391
AfiI CCNNNNNNNGG 3 cut(s) 178, 393, 521
AgsI TTSAA 2 cut(s) 98, 504
AjnI CCWGG 2 cut(s) 376, 410
AluBI AGCT 5 cut(s) 20, 32, 229, 295, 304
AluI AGCT 5 cut(s) 20, 32, 229, 295, 304
Alw26I GTCTC 1 cut(s) 212
AlwI GGATC 1 cut(s) 214
AlwNI CAGNNNCTG 1 cut(s) 229
Aor51HI AGCGCT 1 cut(s) 391
AoxI GGCC 5 cut(s) 90, 148, 395, 408, 525
ApeKI GCWGC 3 cut(s) 64, 226, 304
AspLEI GCGC 1 cut(s) 392
AspS9I GGNCC 3 cut(s) 78, 148, 525
AvaII GGWCC 1 cut(s) 78
BalI TGGCCA 1 cut(s) 397
BanI GGYRCC 1 cut(s) 366
BbrPI CACGTG 1 cut(s) 256
BbvI GCAGC 3 cut(s) 51, 238, 291
BccI CCATC 1 cut(s) 184
BceAI ACGGC 1 cut(s) 77
BciT130I CCWGG 2 cut(s) 378, 412
BcoDI GTCTC 1 cut(s) 212
BfaI CTAG 1 cut(s) 33
BfoI RGCGCY 1 cut(s) 393
BisI GCNGC 3 cut(s) 65, 227, 305
BlsI GCNGC 3 cut(s) 66, 228, 306
Bme1390I CCNGG 2 cut(s) 378, 412
Bme18I GGWCC 1 cut(s) 78
BmgT120I GGNCC 3 cut(s) 78, 148, 525
BmiI GGNNCC 3 cut(s) 38, 368, 526
BmrFI CCNGG 2 cut(s) 378, 412
BmsI GCATC 3 cut(s) 420, 435, 465
BpmI CTGGAG 1 cut(s) 344
BpuEI CTTGAG 2 cut(s) 194, 514
BsaAI YACGTR 2 cut(s) 256, 518
BsaHI GRCGYC 1 cut(s) 9
Bsc4I CCNNNNNNNGG 3 cut(s) 178, 393, 521
BseBI CCWGG 2 cut(s) 378, 412
BseGI GGATG 1 cut(s) 383
BseLI CCNNNNNNNGG 3 cut(s) 178, 393, 521
BseRI GAGGAG 1 cut(s) 32
BseXI GCAGC 3 cut(s) 51, 238, 291
BshFI GGCC 5 cut(s) 92, 150, 397, 410, 527
BshNI GGYRCC 1 cut(s) 366
BslFI GGGAC 1 cut(s) 88
BslI CCNNNNNNNGG 3 cut(s) 178, 393, 521
BsmAI GTCTC 1 cut(s) 212
BsmFI GGGAC 1 cut(s) 88
BsmI GAATGC 1 cut(s) 421
BsnI GGCC 5 cut(s) 92, 150, 397, 410, 527
Bsp143I GATC 1 cut(s) 219
BspACI CCGC 4 cut(s) 166, 438, 468, 498
BspANI GGCC 5 cut(s) 92, 150, 397, 410, 527
BspLI GGNNCC 3 cut(s) 38, 368, 526
BspPI GGATC 1 cut(s) 214
BspT107I GGYRCC 1 cut(s) 366
BsrBI CCGCTC 3 cut(s) 168, 440, 470
BssMI GATC 1 cut(s) 219
BssNI GRCGYC 1 cut(s) 9
Bst2UI CCWGG 2 cut(s) 378, 412
Bst4CI ACNGT 2 cut(s) 78, 338
Bst6I CTCTTC 1 cut(s) 281
BstACI GRCGYC 1 cut(s) 9
BstBAI YACGTR 2 cut(s) 256, 518
BstC8I GCNNGC 4 cut(s) 158, 162, 166, 261
BstDEI CTNAG 1 cut(s) 113
BstF5I GGATG 1 cut(s) 383
BstH2I RGCGCY 1 cut(s) 393
BstHHI GCGC 1 cut(s) 392
BstKTI GATC 1 cut(s) 222
BstMAI GTCTC 1 cut(s) 212
BstMBI GATC 1 cut(s) 219
BstMWI GCNNNNNNNGC 4 cut(s) 17, 301, 387, 416
BstNI CCWGG 2 cut(s) 378, 412
BstSCI CCNGG 2 cut(s) 376, 410
BstV1I GCAGC 3 cut(s) 51, 238, 291
BstX2I RGATCY 1 cut(s) 219
BstYI RGATCY 1 cut(s) 219
BsuRI GGCC 5 cut(s) 92, 150, 397, 410, 527
BtsCI GGATG 1 cut(s) 383
BtsIMutI CAGTG 1 cut(s) 128
Cac8I GCNNGC 4 cut(s) 158, 162, 166, 261
CaiI CAGNNNCTG 1 cut(s) 229
CfoI GCGC 1 cut(s) 392
Cfr13I GGNCC 3 cut(s) 78, 148, 525
CpoI CGGWCCG 1 cut(s) 78
CseI GACGC 1 cut(s) 17
CspI CGGWCCG 1 cut(s) 78
CviAII CATG 2 cut(s) 145, 283
DdeI CTNAG 1 cut(s) 113
DpnI GATC 1 cut(s) 221
DpnII GATC 1 cut(s) 219
DraIII CACNNNGTG 2 cut(s) 116, 521
EaeI YGGCCR 2 cut(s) 90, 395
Eam1104I CTCTTC 1 cut(s) 281
EarI CTCTTC 1 cut(s) 281
Eco147I AGGCCT 1 cut(s) 410
Eco47I GGWCC 1 cut(s) 78
Eco47III AGCGCT 1 cut(s) 391
Eco57I CTGAAG 2 cut(s) 251, 336
Eco72I CACGTG 1 cut(s) 256
EcoO109I RGGNCCY 1 cut(s) 525
EcoRII CCWGG 2 cut(s) 376, 410
FaeI CATG 2 cut(s) 148, 286
FaiI YATR 4 cut(s) 146, 237, 284, 330
FaqI GGGAC 1 cut(s) 88
FatI CATG 2 cut(s) 144, 282
FauI CCCGC 2 cut(s) 173, 445
Fnu4HI GCNGC 3 cut(s) 65, 227, 305
FokI GGATG 1 cut(s) 370
Fsp4HI GCNGC 3 cut(s) 65, 227, 305
FspBI CTAG 1 cut(s) 33
GlaI GCGC 1 cut(s) 391
GluI GCNGC 3 cut(s) 65, 227, 305
GsuI CTGGAG 1 cut(s) 344
HaeII RGCGCY 1 cut(s) 393
HaeIII GGCC 5 cut(s) 92, 150, 397, 410, 527
HgaI GACGC 1 cut(s) 17
HhaI GCGC 1 cut(s) 392
Hin1I GRCGYC 1 cut(s) 9
Hin1II CATG 2 cut(s) 148, 286
Hin6I GCGC 1 cut(s) 390
HinP1I GCGC 1 cut(s) 390
HindIII AAGCTT 1 cut(s) 293
HinfI GANTC 4 cut(s) 101, 182, 311, 325
Hpy188I TCNGA 6 cut(s) 51, 82, 316, 324, 444, 474
Hpy188III TCNNGA 4 cut(s) 72, 98, 361, 504
Hpy99I CGWCG 1 cut(s) 280
HpyAV CCTTC 5 cut(s) 311, 459, 474, 489, 504
HpyCH4III ACNGT 2 cut(s) 78, 338
HpyCH4IV ACGT 2 cut(s) 255, 517
HpyCH4V TGCA 4 cut(s) 4, 253, 263, 307
HpyF10VI GCNNNNNNNGC 4 cut(s) 17, 301, 387, 416
HpyF3I CTNAG 1 cut(s) 113
HpySE526I ACGT 2 cut(s) 255, 517
Hsp92I GRCGYC 1 cut(s) 9
Hsp92II CATG 2 cut(s) 148, 286
HspAI GCGC 1 cut(s) 390
Kzo9I GATC 1 cut(s) 219
LmnI GCTCC 4 cut(s) 173, 445, 460, 475
Lsp1109I GCAGC 3 cut(s) 51, 238, 291
LweI GCATC 3 cut(s) 420, 435, 465
MaeI CTAG 1 cut(s) 33
MaeII ACGT 2 cut(s) 255, 517
MaeIII GTNAC 1 cut(s) 332
MalI GATC 1 cut(s) 221
MbiI CCGCTC 3 cut(s) 168, 440, 470
MboI GATC 1 cut(s) 219
MboII GAAGA 2 cut(s) 298, 417
MflI RGATCY 1 cut(s) 219
MlsI TGGCCA 1 cut(s) 397
MluNI TGGCCA 1 cut(s) 397
MlyI GAGTC 2 cut(s) 110, 320
MmeI TCCRAC 2 cut(s) 165, 302
Mox20I TGGCCA 1 cut(s) 397
MscI TGGCCA 1 cut(s) 397
Msp20I TGGCCA 1 cut(s) 397
MspA1I CMGCKG 1 cut(s) 229
MspR9I CCNGG 2 cut(s) 378, 412
Mva1269I GAATGC 1 cut(s) 421
MvaI CCWGG 2 cut(s) 378, 412
MwoI GCNNNNNNNGC 4 cut(s) 17, 301, 387, 416
NdeII GATC 1 cut(s) 219
NlaIII CATG 2 cut(s) 148, 286
NlaIV GGNNCC 3 cut(s) 38, 368, 526
NmuCI GTSAC 1 cut(s) 332
PceI AGGCCT 1 cut(s) 410
PctI GAATGC 1 cut(s) 421
PfeI GAWTC 2 cut(s) 182, 325
PflMI CCANNNNNTGG 2 cut(s) 393, 521
PkrI GCNGC 3 cut(s) 66, 228, 306
PleI GAGTC 2 cut(s) 109, 319
PmaCI CACGTG 1 cut(s) 256
PmlI CACGTG 1 cut(s) 256
PpsI GAGTC 2 cut(s) 109, 319
Ppu21I YACGTR 2 cut(s) 256, 518
Psp6I CCWGG 2 cut(s) 376, 410
PspCI CACGTG 1 cut(s) 256
PspGI CCWGG 2 cut(s) 376, 410
PspN4I GGNNCC 3 cut(s) 38, 368, 526
PspPI GGNCC 3 cut(s) 78, 148, 525
PstNI CAGNNNCTG 1 cut(s) 229
PsuI RGATCY 1 cut(s) 219
PvuII CAGCTG 1 cut(s) 229
Rsr2I CGGWCCG 1 cut(s) 78
RsrII CGGWCCG 1 cut(s) 78
SatI GCNGC 3 cut(s) 65, 227, 305
Sau3AI GATC 1 cut(s) 219
Sau96I GGNCC 3 cut(s) 78, 148, 525
SchI GAGTC 2 cut(s) 110, 320
ScrFI CCNGG 2 cut(s) 378, 412
SfaNI GCATC 3 cut(s) 420, 435, 465
SinI GGWCC 1 cut(s) 78
SmlI CTYRAG 2 cut(s) 209, 529
SmoI CTYRAG 2 cut(s) 209, 529
SseBI AGGCCT 1 cut(s) 410
SsiI CCGC 4 cut(s) 166, 438, 468, 498
SspMI CTAG 1 cut(s) 33
StuI AGGCCT 1 cut(s) 410
StyD4I CCNGG 2 cut(s) 376, 410
TaaI ACNGT 2 cut(s) 78, 338
TaiI ACGT 2 cut(s) 258, 520
TaqI TCGA 2 cut(s) 275, 428
TfiI GAWTC 2 cut(s) 182, 325
TscAI CASTG 1 cut(s) 128
TseFI GTSAC 1 cut(s) 332
TseI GCWGC 3 cut(s) 64, 226, 304
Tsp45I GTSAC 1 cut(s) 332
TspDTI ATGAA 2 cut(s) 299, 317
TspRI CASTG 1 cut(s) 128
Van91I CCANNNNNTGG 2 cut(s) 393, 521
VpaK11BI GGWCC 1 cut(s) 78
XspI CTAG 1 cut(s) 33
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.