Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr17

Orthogroup ID

OG0000120

Physical Location & Seq

Genomic Coordinates Reverse (-)

23258368 .. 23259201

Gene Structure 834 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom17g25100.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 834 bp

ATGCGTCGCCGAACTTCACGCAGGAAAATCCGGATTTTTGAATCGGTGATCGTGTCGCTTGGCTTTTTACAGAGGTATCGATCACTCCAACATACACACTCTGAAAATTGCCCATTCTTGAAAATCGTCTCCGGCCTTTTGAGAATTATCTTCATCCACCCATTCTCTCTGAACACCTTTGAAAAAATGACTAACTCATCGAACCTTTGCTTAGATTTGAGTCTCAGCAGCGATCCGGTTGCACCCGGTCAAGGTAATGTATGGCGCCCTTCTTTTTTATCTTCTAACGGTCCTCTTACAGGTGAAGACTCCGTGATGCAGGACGCCACAACGGCTACAATAGTAGCTAGGAACCTCCTCACTCCAAAAGATAGTAGGCTGCTGTCAGGACGGTCCGATGAGTTGGCCGTTCAAGAGTCCCTCGCTCTCAGCGTTCAGTGTGCAGGCTCTGTGTCCAACATGGGCCAACGCCTGCTTGCTCGGTCCCGTCAGGTGGAATCATTGATGGCAGAGGTGGAAAATCTTAAGCAGGAGATCAAACAGCTTAAGTACGAGAATAGAAGTTTGCACGTGCTTGCAAATAACTATTCGTCGGGCATGAAGAGGAAGCTTGATGAGCTGCAAGAATCTGAAGGTCGGATTCAAAGTGACCGTCAAAGGTTTTCGTCTTTCCTCCAGAGGCACATTTTTCCTGGGTCTTCCAGCGTTTGGCCAAGTATTGAGGCCTGGAATGCTCTAGCTTCAATGCCTCCCGCTCCGATGCCTTCTGCTCCGATGCCTTCCGCTTCTAGAGTTTTGCCAAGTAATGGGGCTTCACGTGAACATCCTTTGTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004177 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005829 GO:0006508 GO:0006807 GO:0008150 GO:0008152 GO:0008233 GO:0008238 GO:0008239 GO:0016787 GO:0019538 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044238 GO:0044424 GO:0044444 GO:0044464 GO:0070011 GO:0071704 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

NUDIX Peptidase_M49

Protein Analysis

278

Amino Acids

30.88

Weight (kDa)

9.88

Isoelectric Point (pI)

66.19

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000120)

Species	Orthologous Gene IDs
malus_domestica	MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica	Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis	pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	264
AccB7I	CCANNNNNTGG	2 cut(s)	708, 806
AccBSI	CCGCTC	1 cut(s)	755
AccIII	TCCGGA	1 cut(s)	30
AciI	CCGC	2 cut(s)	753, 783
AclWI	GGATC	1 cut(s)	227
AcoI	YGGCCR	2 cut(s)	405, 710
AcuI	CTGAAG	1 cut(s)	651
AcvI	CACGTG	2 cut(s)	571, 818
AcyI	GRCGYC	2 cut(s)	265, 324
AfaI	GTAC	1 cut(s)	551
AfiI	CCNNNNNNNGG	5 cut(s)	251, 299, 493, 708, 806
AflII	CTTAAG	2 cut(s)	524, 545
AgsI	TTSAA	6 cut(s)	41, 121, 182, 413, 644, 744
AjnI	CCWGG	2 cut(s)	691, 725
AluBI	AGCT	5 cut(s)	347, 544, 610, 619, 740
AluI	AGCT	5 cut(s)	347, 544, 610, 619, 740
Alw26I	GTCTC	2 cut(s)	133, 227
AlwI	GGATC	1 cut(s)	227
AlwNI	CAGNNNCTG	1 cut(s)	449
Aor13HI	TCCGGA	1 cut(s)	30
AoxI	GGCC	5 cut(s)	133, 405, 463, 710, 723
ApeKI	GCWGC	3 cut(s)	228, 379, 619
ArsI	GACNNNNNNTTYG	2 cut(s)	637, 669
AspLEI	GCGC	1 cut(s)	267
AspS9I	GGNCC	4 cut(s)	290, 393, 463, 483
AsuC2I	CCSGG	1 cut(s)	246
AsuHPI	GGTGA	2 cut(s)	58, 314
AvaII	GGWCC	3 cut(s)	290, 393, 483
BaeI	ACNNNNGTAYC	2 cut(s)	59, 92
BalI	TGGCCA	1 cut(s)	712
BanI	GGYRCC	1 cut(s)	264
BarI	GAAGNNNNNNTAC	2 cut(s)	796, 828
BbrPI	CACGTG	2 cut(s)	571, 818
BbsI	GAAGAC	2 cut(s)	312, 690
BbvI	GCAGC	3 cut(s)	240, 366, 606
BccI	CCATC	1 cut(s)	499
BceAI	ACGGC	2 cut(s)	348, 392
BcgI	CGANNNNNNTGC	2 cut(s)	221, 255
BciT130I	CCWGG	2 cut(s)	693, 727
BcnI	CCSGG	1 cut(s)	246
BcoDI	GTCTC	2 cut(s)	133, 227
BfaI	CTAG	3 cut(s)	348, 737, 789
BfoI	RGCGCY	1 cut(s)	268
BfrI	CTTAAG	2 cut(s)	524, 545
BglI	GCCNNNNNGGC	1 cut(s)	332
BisI	GCNGC	3 cut(s)	229, 380, 620
BlsI	GCNGC	3 cut(s)	230, 381, 621
Bme1390I	CCNGG	3 cut(s)	246, 693, 727
Bme18I	GGWCC	3 cut(s)	290, 393, 483
BmgT120I	GGNCC	4 cut(s)	290, 393, 463, 483
BmiI	GGNNCC	3 cut(s)	266, 353, 485
BmrFI	CCNGG	3 cut(s)	246, 693, 727
BmsI	GCATC	3 cut(s)	306, 750, 765
BpiI	GAAGAC	2 cut(s)	312, 690
BpmI	CTGGAG	1 cut(s)	659
BpuMI	CCSGG	1 cut(s)	246
Bsa29I	ATCGAT	1 cut(s)	79
BsaAI	YACGTR	2 cut(s)	571, 818
BsaHI	GRCGYC	2 cut(s)	265, 324
BsaJI	CCNNGG	1 cut(s)	692
BsaWI	WCCGGW	2 cut(s)	30, 235
Bsc4I	CCNNNNNNNGG	5 cut(s)	251, 299, 493, 708, 806
BseAI	TCCGGA	1 cut(s)	30
BseBI	CCWGG	2 cut(s)	693, 727
BseCI	ATCGAT	1 cut(s)	79
BseDI	CCNNGG	1 cut(s)	692
BseGI	GGATG	2 cut(s)	153, 823
BseLI	CCNNNNNNNGG	5 cut(s)	251, 299, 493, 708, 806
BseMII	CTCAG	2 cut(s)	238, 442
BseRI	GAGGAG	1 cut(s)	347
BseXI	GCAGC	3 cut(s)	240, 366, 606
BsgI	GTGCAG	1 cut(s)	462
BshFI	GGCC	5 cut(s)	135, 407, 465, 712, 725
BshNI	GGYRCC	1 cut(s)	264
BshVI	ATCGAT	1 cut(s)	79
BsiSI	CCGG	4 cut(s)	31, 132, 236, 246
BslFI	GGGAC	2 cut(s)	403, 469
BslI	CCNNNNNNNGG	5 cut(s)	251, 299, 493, 708, 806
BsmAI	GTCTC	2 cut(s)	133, 227
BsmBI	CGTCTC	1 cut(s)	133
BsmFI	GGGAC	2 cut(s)	403, 469
BsmI	GAATGC	1 cut(s)	736
BsnI	GGCC	5 cut(s)	135, 407, 465, 712, 725
Bsp13I	TCCGGA	1 cut(s)	30
Bsp143I	GATC	4 cut(s)	48, 80, 232, 534
BspACI	CCGC	2 cut(s)	753, 783
BspANI	GGCC	5 cut(s)	135, 407, 465, 712, 725
BspCNI	CTCAG	2 cut(s)	237, 441
BspDI	ATCGAT	1 cut(s)	79
BspEI	TCCGGA	1 cut(s)	30
BspLI	GGNNCC	3 cut(s)	266, 353, 485
BspPI	GGATC	1 cut(s)	227
BspT107I	GGYRCC	1 cut(s)	264
BspTI	CTTAAG	2 cut(s)	524, 545
BsrBI	CCGCTC	1 cut(s)	755
BssECI	CCNNGG	1 cut(s)	692
BssMI	GATC	4 cut(s)	48, 80, 232, 534
BssNI	GRCGYC	2 cut(s)	265, 324
Bst2UI	CCWGG	2 cut(s)	693, 727
Bst4CI	ACNGT	3 cut(s)	290, 393, 653
Bst6I	CTCTTC	1 cut(s)	596
BstACI	GRCGYC	2 cut(s)	265, 324
BstAFI	CTTAAG	2 cut(s)	524, 545
BstBAI	YACGTR	2 cut(s)	571, 818
BstC8I	GCNNGC	4 cut(s)	445, 473, 477, 576
BstDEI	CTNAG	3 cut(s)	211, 224, 428
BstENI	CCTNNNNNAGG	1 cut(s)	297
BstF5I	GGATG	2 cut(s)	153, 823
BstH2I	RGCGCY	1 cut(s)	268
BstHHI	GCGC	1 cut(s)	267
BstKTI	GATC	4 cut(s)	51, 83, 235, 537
BstMAI	GTCTC	2 cut(s)	133, 227
BstMBI	GATC	4 cut(s)	48, 80, 232, 534
BstMWI	GCNNNNNNNGC	3 cut(s)	332, 616, 731
BstNI	CCWGG	2 cut(s)	693, 727
BstSCI	CCNGG	3 cut(s)	244, 691, 725
BstV1I	GCAGC	3 cut(s)	240, 366, 606
BstV2I	GAAGAC	2 cut(s)	312, 690
Bsu15I	ATCGAT	1 cut(s)	79
BsuRI	GGCC	5 cut(s)	135, 407, 465, 712, 725
BsuTUI	ATCGAT	1 cut(s)	79
BtsCI	GGATG	2 cut(s)	153, 823
BtsIMutI	CAGTG	1 cut(s)	443
Cac8I	GCNNGC	4 cut(s)	445, 473, 477, 576
CaiI	CAGNNNCTG	1 cut(s)	449
CfoI	GCGC	1 cut(s)	267
Cfr13I	GGNCC	4 cut(s)	290, 393, 463, 483
ClaI	ATCGAT	1 cut(s)	79
CpoI	CGGWCCG	1 cut(s)	393
CseI	GACGC	1 cut(s)	332
Csp6I	GTAC	1 cut(s)	550
CspI	CGGWCCG	1 cut(s)	393
CviAII	CATG	2 cut(s)	460, 598
CviQI	GTAC	1 cut(s)	550
DdeI	CTNAG	3 cut(s)	211, 224, 428
DinI	GGCGCC	1 cut(s)	266
DpnI	GATC	4 cut(s)	50, 82, 234, 536
DpnII	GATC	4 cut(s)	48, 80, 232, 534
EaeI	YGGCCR	2 cut(s)	405, 710
Eam1104I	CTCTTC	1 cut(s)	596
EarI	CTCTTC	1 cut(s)	596
Eco147I	AGGCCT	1 cut(s)	725
Eco47I	GGWCC	3 cut(s)	290, 393, 483
Eco57I	CTGAAG	1 cut(s)	651
Eco72I	CACGTG	2 cut(s)	571, 818
EcoNI	CCTNNNNNAGG	1 cut(s)	297
EcoRII	CCWGG	2 cut(s)	691, 725
EgeI	GGCGCC	1 cut(s)	266
EheI	GGCGCC	1 cut(s)	266
Esp3I	CGTCTC	1 cut(s)	133
FaeI	CATG	2 cut(s)	463, 601
FaiI	YATR	4 cut(s)	93, 262, 461, 599
FaqI	GGGAC	2 cut(s)	403, 469
FatI	CATG	2 cut(s)	459, 597
FauI	CCCGC	1 cut(s)	760
Fnu4HI	GCNGC	3 cut(s)	229, 380, 620
FokI	GGATG	2 cut(s)	140, 810
Fsp4HI	GCNGC	3 cut(s)	229, 380, 620
FspBI	CTAG	3 cut(s)	348, 737, 789
GlaI	GCGC	1 cut(s)	266
GluI	GCNGC	3 cut(s)	229, 380, 620
GsuI	CTGGAG	1 cut(s)	659
HaeII	RGCGCY	1 cut(s)	268
HaeIII	GGCC	5 cut(s)	135, 407, 465, 712, 725
HapII	CCGG	4 cut(s)	31, 132, 236, 246
HgaI	GACGC	1 cut(s)	332
HhaI	GCGC	1 cut(s)	267
Hin1I	GRCGYC	2 cut(s)	265, 324
Hin1II	CATG	2 cut(s)	463, 601
Hin6I	GCGC	1 cut(s)	265
HinP1I	GCGC	1 cut(s)	265
HindIII	AAGCTT	1 cut(s)	608
HinfI	GANTC	7 cut(s)	41, 220, 308, 416, 497, 626, 640
HpaII	CCGG	4 cut(s)	31, 132, 236, 246
HphI	GGTGA	2 cut(s)	58, 314
Hpy166II	GTNNAC	1 cut(s)	821
Hpy188I	TCNGA	7 cut(s)	103, 171, 397, 631, 639, 759, 774
Hpy188III	TCNNGA	6 cut(s)	31, 118, 387, 413, 676, 789
Hpy8I	GTNNAC	1 cut(s)	821
Hpy99I	CGWCG	2 cut(s)	9, 595
HpyAV	CCTTC	4 cut(s)	279, 626, 774, 789
HpyCH4III	ACNGT	3 cut(s)	290, 393, 653
HpyCH4IV	ACGT	2 cut(s)	570, 817
HpyCH4V	TGCA	6 cut(s)	242, 319, 443, 568, 578, 622
HpyF10VI	GCNNNNNNNGC	3 cut(s)	332, 616, 731
HpyF3I	CTNAG	3 cut(s)	211, 224, 428
HpySE526I	ACGT	2 cut(s)	570, 817
Hsp92I	GRCGYC	2 cut(s)	265, 324
Hsp92II	CATG	2 cut(s)	463, 601
HspAI	GCGC	1 cut(s)	265
KasI	GGCGCC	1 cut(s)	264
Kpn2I	TCCGGA	1 cut(s)	30
Kzo9I	GATC	4 cut(s)	48, 80, 232, 534
LmnI	GCTCC	2 cut(s)	760, 775
Lsp1109I	GCAGC	3 cut(s)	240, 366, 606
LweI	GCATC	3 cut(s)	306, 750, 765
MaeI	CTAG	3 cut(s)	348, 737, 789
MaeII	ACGT	2 cut(s)	570, 817
MaeIII	GTNAC	1 cut(s)	647
MalI	GATC	4 cut(s)	50, 82, 234, 536
MbiI	CCGCTC	1 cut(s)	755
MboI	GATC	4 cut(s)	48, 80, 232, 534
MboII	GAAGA	5 cut(s)	142, 273, 317, 613, 690
MlsI	TGGCCA	1 cut(s)	712
MluCI	AATT	2 cut(s)	106, 144
MluNI	TGGCCA	1 cut(s)	712
Mly113I	GGCGCC	1 cut(s)	265
MlyI	GAGTC	3 cut(s)	229, 302, 425
MmeI	TCCRAC	3 cut(s)	112, 480, 617
Mox20I	TGGCCA	1 cut(s)	712
MroI	TCCGGA	1 cut(s)	30
MscI	TGGCCA	1 cut(s)	712
MseI	TTAA	2 cut(s)	525, 546
Msp20I	TGGCCA	1 cut(s)	712
MspCI	CTTAAG	2 cut(s)	524, 545
MspI	CCGG	4 cut(s)	31, 132, 236, 246
MspR9I	CCNGG	3 cut(s)	246, 693, 727
Mva1269I	GAATGC	1 cut(s)	736
MvaI	CCWGG	2 cut(s)	693, 727
MwoI	GCNNNNNNNGC	3 cut(s)	332, 616, 731
NarI	GGCGCC	1 cut(s)	265
NciI	CCSGG	1 cut(s)	246
NdeII	GATC	4 cut(s)	48, 80, 232, 534
NlaIII	CATG	2 cut(s)	463, 601
NlaIV	GGNNCC	3 cut(s)	266, 353, 485
NmuCI	GTSAC	1 cut(s)	647
PceI	AGGCCT	1 cut(s)	725
PcsI	WCGNNNNNNNCGW	1 cut(s)	429
PctI	GAATGC	1 cut(s)	736
PfeI	GAWTC	4 cut(s)	41, 497, 626, 640
PflMI	CCANNNNNTGG	2 cut(s)	708, 806
PkrI	GCNGC	3 cut(s)	230, 381, 621
PleI	GAGTC	3 cut(s)	228, 302, 424
PluTI	GGCGCC	1 cut(s)	268
PmaCI	CACGTG	2 cut(s)	571, 818
PmlI	CACGTG	2 cut(s)	571, 818
PpsI	GAGTC	3 cut(s)	228, 302, 424
Ppu21I	YACGTR	2 cut(s)	571, 818
Psp6I	CCWGG	2 cut(s)	691, 725
PspCI	CACGTG	2 cut(s)	571, 818
PspGI	CCWGG	2 cut(s)	691, 725
PspN4I	GGNNCC	3 cut(s)	266, 353, 485
PspPI	GGNCC	4 cut(s)	290, 393, 463, 483
PstNI	CAGNNNCTG	1 cut(s)	449
RsaI	GTAC	1 cut(s)	551
RsaNI	GTAC	1 cut(s)	550
Rsr2I	CGGWCCG	1 cut(s)	393
RsrII	CGGWCCG	1 cut(s)	393
SaqAI	TTAA	2 cut(s)	525, 546
SatI	GCNGC	3 cut(s)	229, 380, 620
Sau3AI	GATC	4 cut(s)	48, 80, 232, 534
Sau96I	GGNCC	4 cut(s)	290, 393, 463, 483
SchI	GAGTC	3 cut(s)	229, 302, 425
ScrFI	CCNGG	3 cut(s)	246, 693, 727
SfaNI	GCATC	3 cut(s)	306, 750, 765
SfoI	GGCGCC	1 cut(s)	266
SinI	GGWCC	3 cut(s)	290, 393, 483
SmlI	CTYRAG	2 cut(s)	524, 545
SmoI	CTYRAG	2 cut(s)	524, 545
Sse9I	AATT	2 cut(s)	106, 144
SseBI	AGGCCT	1 cut(s)	725
SsiI	CCGC	2 cut(s)	753, 783
SspDI	GGCGCC	1 cut(s)	264
SspMI	CTAG	3 cut(s)	348, 737, 789
StuI	AGGCCT	1 cut(s)	725
StyD4I	CCNGG	3 cut(s)	244, 691, 725
TaaI	ACNGT	3 cut(s)	290, 393, 653
TaiI	ACGT	2 cut(s)	573, 820
TaqI	TCGA	2 cut(s)	79, 200
TaqII	GACCGA	1 cut(s)	471
TasI	AATT	2 cut(s)	106, 144
TfiI	GAWTC	4 cut(s)	41, 497, 626, 640
Tru1I	TTAA	2 cut(s)	525, 546
Tru9I	TTAA	2 cut(s)	525, 546
TscAI	CASTG	1 cut(s)	443
TseFI	GTSAC	1 cut(s)	647
TseI	GCWGC	3 cut(s)	228, 379, 619
Tsp45I	GTSAC	1 cut(s)	647
TspDTI	ATGAA	2 cut(s)	142, 614
TspGWI	ACGGA	1 cut(s)	301
TspRI	CASTG	1 cut(s)	443
Van91I	CCANNNNNTGG	2 cut(s)	708, 806
Vha464I	CTTAAG	2 cut(s)	524, 545
VpaK11BI	GGWCC	3 cut(s)	290, 393, 483
XagI	CCTNNNNNAGG	1 cut(s)	297
XbaI	TCTAGA	1 cut(s)	788
XspI	CTAG	3 cut(s)	348, 737, 789

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.