pycom13g27560

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
Physical Location & Seq
Forward (+)
23766830 .. 23769008
2179 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom13g27560.13

Sequence Viewer

Length: 1419 bp
ATGCCAGTTTCTATGGAGTTCATAAACTTTTTTAAAGGGGTAATTACAGTTTACCCCCTCCACTTTGTTTGTTGTGAAATTGAGGATAAGTGTGCGGTGAAATATAAAGTAAATAAAACACAATATTTACGAGGTTTGGCAAGTGTGCCTACTTCCTTAGGACAACAATACTTACTGATATATTTCTCTTCTACGTCCTCTACTACTTCTTCTCCTCTTGGTTTTATAGGCAGATGGCTTACCATCCTTTCTTCATTCAACCTTACATTTCCAATAGTCAATAATATTAAATACAAAATCACACTGCTTTTACAACACTCTCCCTTGGAGGTCCATATGTCAATATTGGTTGCCACATTAACAAAAGTACAACACACATATGTCTTGGATGCTCCCCCTGATGAGTATACAAAATCGCGTAATCCGATATTATGCACCAACTTATGGAATATACAATTTGGTAGAGATTTGGTGAAGAGGTCTGGAAGATTATTGTTGGAACGGATTTGTTTAACTTCAATAACTTTAGCTTTCTTAAGCTCATACGAAGATGTAACAACAAATGTTTGCTTCATTGAGTGTTATAGGATTAATCTATTTCCATATGAAAATACAAATCTTTTCTATGAGCTATCTTTTTGCATAATTTTTCAGAGATATCAATGGATAAGTTTCACTTCATTCCAATACCCATATGTTGGTATTGTGCTTCACATGAAATTTTTCACTAAGATATGGTACTTCTGGACCAAATATCAATTCATTATTTCTCTCACGAGGAAGAATGATCTTTCTTATTGTCTAAATACCATAAACATTTTGATGGATAAGAATTGTGTTGGTATATTGTTCGATCTGCAGTTCGAGACAATATTCCTTTCAACACCTTATAATTTTTCTAGACTCTTCAAAAGTCCCAATCTAATATCAACTCTTGCTAGAGATTTAGTATGTTGCAACAATATCATAATGATAGTACTCACTAAGGTTAACTATAAGGATTTTGAATCCTTCAGTAATTTTCTACATTTCATGACATATTCTCCTTTGAAATTTATACAGAGTAATTTGTTTCTATGTATAATTGAGGGATTTATTTATGAAGATATGCTTAAGGAATTTCAGAATTTCACAATGGGAAATCATGTTTACAAAAATGTATTAAAATTTCAGGTTTCAACTAGGATCCTCATGTCATATTATCATCCTTGTCTTTTGATCGTCATAGAGTCAGGTAGAGTTCGATGGGGTTGTGACTACTCATTTTCTCCATTTGAACTTCTATGGGTTTTGGTGTGCATAACCTTGTGCCTTTGGATGATCCTTCAAAACATCATTTCTGTTGACTCATCCATGCTTAGCAGCTTCGATGCAAAAAGCCAACATCGTACCAACTGTTTAGCGGTGTTGATGATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

473

Amino Acids

55.27

Weight (kDa)

8.6

Isoelectric Point (pI)

42.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 891
AccB7I CCANNNNNTGG 2 cut(s) 444, 698
AccI GTMKAC 1 cut(s) 407
AccII CGCG 1 cut(s) 418
AciI CCGC 2 cut(s) 95, 1403
AclWI GGATC 3 cut(s) 1180, 1193, 1315
AcsI RAATTY 5 cut(s) 719, 1052, 1118, 1126, 1166
AcuI CTGAAG 1 cut(s) 997
AfaI GTAC 4 cut(s) 369, 740, 978, 1390
AfiI CCNNNNNNNGG 2 cut(s) 444, 698
AflII CTTAAG 2 cut(s) 535, 1112
AgsI TTSAA 9 cut(s) 259, 519, 882, 910, 1007, 1051, 1179, 1277, 1328
AjuI GAANNNNNNNTTGG 2 cut(s) 743, 775
AluBI AGCT 4 cut(s) 530, 540, 631, 1365
AluI AGCT 4 cut(s) 530, 540, 631, 1365
Alw26I GTCTC 1 cut(s) 860
AlwI GGATC 3 cut(s) 1180, 1193, 1315
ApeKI GCWGC 1 cut(s) 1362
ApoI RAATTY 5 cut(s) 719, 1052, 1118, 1126, 1166
AseI ATTAAT 1 cut(s) 591
Asp700I GAANNNNTTC 1 cut(s) 722
AspS9I GGNCC 2 cut(s) 331, 747
AsuHPI GGTGA 2 cut(s) 109, 484
AvaII GGWCC 2 cut(s) 331, 747
AxyI CCTNAGG 1 cut(s) 157
BamHI GGATCC 1 cut(s) 1185
BauI CACGAG 1 cut(s) 775
BbvI GCAGC 1 cut(s) 1374
BccI CCATC 4 cut(s) 228, 251, 817, 1239
BcoDI GTCTC 1 cut(s) 860
BfaI CTAG 3 cut(s) 900, 939, 1182
BfmI CTRYAG 1 cut(s) 857
BfrI CTTAAG 2 cut(s) 535, 1112
BisI GCNGC 1 cut(s) 1363
BlpI GCTNAGC 1 cut(s) 1358
BlsI GCNGC 1 cut(s) 1364
BmcAI AGTACT 1 cut(s) 978
Bme18I GGWCC 2 cut(s) 331, 747
BmgT120I GGNCC 2 cut(s) 331, 747
BmiI GGNNCC 1 cut(s) 1187
BmsI GCATC 2 cut(s) 379, 1360
Bpu1102I GCTNAGC 1 cut(s) 1358
BsaJI CCNNGG 1 cut(s) 324
BsaXI ACNNNNNCTCC 4 cut(s) 196, 226, 1027, 1057
Bsc4I CCNNNNNNNGG 2 cut(s) 444, 698
Bse1I ACTGG 1 cut(s) 5
Bse21I CCTNAGG 1 cut(s) 157
BseDI CCNNGG 1 cut(s) 324
BseGI GGATG 5 cut(s) 243, 394, 1204, 1323, 1349
BseLI CCNNNNNNNGG 2 cut(s) 444, 698
BseNI ACTGG 1 cut(s) 5
BseRI GAGGAG 1 cut(s) 204
BseXI GCAGC 1 cut(s) 1374
Bsh1236I CGCG 1 cut(s) 418
BslFI GGGAC 1 cut(s) 900
BslI CCNNNNNNNGG 2 cut(s) 444, 698
BsmAI GTCTC 1 cut(s) 860
BsmFI GGGAC 1 cut(s) 900
Bsp143I GATC 5 cut(s) 787, 853, 1185, 1218, 1320
Bsp1720I GCTNAGC 1 cut(s) 1358
BspACI CCGC 2 cut(s) 95, 1403
BspFNI CGCG 1 cut(s) 418
BspHI TCATGA 1 cut(s) 1032
BspLI GGNNCC 1 cut(s) 1187
BspMAI CTGCAG 1 cut(s) 861
BspPI GGATC 3 cut(s) 1180, 1193, 1315
BspTI CTTAAG 2 cut(s) 535, 1112
BsrI ACTGG 1 cut(s) 5
BssECI CCNNGG 1 cut(s) 324
BssMI GATC 5 cut(s) 787, 853, 1185, 1218, 1320
BssNAI GTATAC 1 cut(s) 408
BssSI CACGAG 1 cut(s) 775
BssT1I CCWWGG 1 cut(s) 324
Bst1107I GTATAC 1 cut(s) 408
Bst2BI CACGAG 1 cut(s) 775
Bst4CI ACNGT 2 cut(s) 49, 1397
Bst6I CTCTTC 3 cut(s) 193, 470, 911
BstAFI CTTAAG 2 cut(s) 535, 1112
BstDEI CTNAG 4 cut(s) 157, 729, 984, 1358
BstF5I GGATG 5 cut(s) 243, 394, 1204, 1323, 1349
BstFNI CGCG 1 cut(s) 418
BstKTI GATC 5 cut(s) 790, 856, 1188, 1221, 1323
BstMAI GTCTC 1 cut(s) 860
BstMBI GATC 5 cut(s) 787, 853, 1185, 1218, 1320
BstSFI CTRYAG 1 cut(s) 857
BstUI CGCG 1 cut(s) 418
BstV1I GCAGC 1 cut(s) 1374
BstX2I RGATCY 1 cut(s) 1185
BstYI RGATCY 1 cut(s) 1185
BstZ17I GTATAC 1 cut(s) 408
Bsu36I CCTNAGG 1 cut(s) 157
BtsCI GGATG 5 cut(s) 243, 394, 1204, 1323, 1349
BtsI GCAGTG 1 cut(s) 302
BtsIMutI CAGTG 1 cut(s) 302
CciI TCATGA 1 cut(s) 1032
Cfr13I GGNCC 2 cut(s) 331, 747
Csp6I GTAC 4 cut(s) 368, 739, 977, 1389
CspCI CAANNNNNGTGG 2 cut(s) 50, 85
CviAII CATG 5 cut(s) 715, 1033, 1145, 1192, 1354
CviJI RGCY 6 cut(s) 238, 530, 540, 631, 1365, 1380
CviKI_1 RGCY 6 cut(s) 238, 530, 540, 631, 1365, 1380
CviQI GTAC 4 cut(s) 368, 739, 977, 1389
DdeI CTNAG 4 cut(s) 157, 729, 984, 1358
DpnI GATC 5 cut(s) 789, 855, 1187, 1220, 1322
DpnII GATC 5 cut(s) 787, 853, 1185, 1218, 1320
DraI TTTAAA 1 cut(s) 34
Eam1104I CTCTTC 3 cut(s) 193, 470, 911
EarI CTCTTC 3 cut(s) 193, 470, 911
Eco130I CCWWGG 1 cut(s) 324
Eco32I GATATC 1 cut(s) 659
Eco47I GGWCC 2 cut(s) 331, 747
Eco57I CTGAAG 1 cut(s) 997
Eco81I CCTNAGG 1 cut(s) 157
EcoRV GATATC 1 cut(s) 659
EcoT14I CCWWGG 1 cut(s) 324
ErhI CCWWGG 1 cut(s) 324
FaeI CATG 5 cut(s) 718, 1036, 1148, 1195, 1357
FalI AAGNNNNNCTT 4 cut(s) 661, 693, 1095, 1127
FaqI GGGAC 1 cut(s) 900
FatI CATG 5 cut(s) 714, 1032, 1144, 1191, 1353
FauNDI CATATG 4 cut(s) 336, 379, 604, 694
FblI GTMKAC 1 cut(s) 407
Fnu4HI GCNGC 1 cut(s) 1363
FokI GGATG 5 cut(s) 230, 401, 1191, 1330, 1336
Fsp4HI GCNGC 1 cut(s) 1363
FspBI CTAG 3 cut(s) 900, 939, 1182
GluI GCNGC 1 cut(s) 1363
Hin1II CATG 5 cut(s) 718, 1036, 1148, 1195, 1357
HincII GTYRAC 2 cut(s) 991, 1345
HindII GTYRAC 2 cut(s) 991, 1345
HinfI GANTC 4 cut(s) 903, 1007, 1229, 1346
HpaI GTTAAC 1 cut(s) 991
HphI GGTGA 2 cut(s) 109, 484
Hpy166II GTNNAC 5 cut(s) 52, 408, 991, 1150, 1345
Hpy188I TCNGA 3 cut(s) 426, 654, 1125
Hpy188III TCNNGA 6 cut(s) 483, 745, 775, 865, 900, 1033
Hpy8I GTNNAC 5 cut(s) 52, 408, 991, 1150, 1345
HpyAV CCTTC 2 cut(s) 1021, 1334
HpyCH4III ACNGT 2 cut(s) 49, 1397
HpyCH4IV ACGT 1 cut(s) 194
HpyCH4V TGCA 6 cut(s) 435, 642, 859, 957, 1299, 1373
HpyF3I CTNAG 4 cut(s) 157, 729, 984, 1358
HpySE526I ACGT 1 cut(s) 194
Hsp92II CATG 5 cut(s) 718, 1036, 1148, 1195, 1357
KspAI GTTAAC 1 cut(s) 991
Kzo9I GATC 5 cut(s) 787, 853, 1185, 1218, 1320
LmnI GCTCC 1 cut(s) 397
LpnPI CCDG 6 cut(s) 18, 411, 468, 730, 1157, 1218
Lsp1109I GCAGC 1 cut(s) 1374
LweI GCATC 2 cut(s) 379, 1360
MaeI CTAG 3 cut(s) 900, 939, 1182
MaeII ACGT 1 cut(s) 194
MaeIII GTNAC 2 cut(s) 553, 1253
MalI GATC 5 cut(s) 789, 855, 1187, 1220, 1322
MboI GATC 5 cut(s) 787, 853, 1185, 1218, 1320
MboII GAAGA 9 cut(s) 180, 201, 243, 487, 498, 560, 793, 898, 1115
MflI RGATCY 1 cut(s) 1185
MlyI GAGTC 3 cut(s) 897, 1238, 1340
MmeI TCCRAC 1 cut(s) 477
MroXI GAANNNNTTC 1 cut(s) 722
MseI TTAA 9 cut(s) 33, 288, 359, 512, 536, 591, 990, 1113, 1163
MslI CAYNNNNRTG 2 cut(s) 378, 821
MspCI CTTAAG 2 cut(s) 535, 1112
MvnI CGCG 1 cut(s) 418
NdeI CATATG 4 cut(s) 336, 379, 604, 694
NdeII GATC 5 cut(s) 787, 853, 1185, 1218, 1320
NlaIII CATG 5 cut(s) 718, 1036, 1148, 1195, 1357
NlaIV GGNNCC 1 cut(s) 1187
NmuCI GTSAC 1 cut(s) 1253
PagI TCATGA 1 cut(s) 1032
PcsI WCGNNNNNNNCGW 1 cut(s) 422
PdmI GAANNNNTTC 1 cut(s) 722
PfeI GAWTC 1 cut(s) 1007
PflMI CCANNNNNTGG 2 cut(s) 444, 698
PkrI GCNGC 1 cut(s) 1364
PleI GAGTC 3 cut(s) 897, 1237, 1340
PpsI GAGTC 3 cut(s) 897, 1237, 1340
PshBI ATTAAT 1 cut(s) 591
PsiI TTATAA 1 cut(s) 891
PspN4I GGNNCC 1 cut(s) 1187
PspPI GGNCC 2 cut(s) 331, 747
PstI CTGCAG 1 cut(s) 861
PsuI RGATCY 1 cut(s) 1185
RsaI GTAC 4 cut(s) 369, 740, 978, 1390
RsaNI GTAC 4 cut(s) 368, 739, 977, 1389
RseI CAYNNNNRTG 2 cut(s) 378, 821
SaqAI TTAA 9 cut(s) 33, 288, 359, 512, 536, 591, 990, 1113, 1163
SatI GCNGC 1 cut(s) 1363
Sau3AI GATC 5 cut(s) 787, 853, 1185, 1218, 1320
Sau96I GGNCC 2 cut(s) 331, 747
ScaI AGTACT 1 cut(s) 978
SchI GAGTC 3 cut(s) 897, 1238, 1340
SfaNI GCATC 2 cut(s) 379, 1360
SfcI CTRYAG 1 cut(s) 857
SinI GGWCC 2 cut(s) 331, 747
SmiMI CAYNNNNRTG 2 cut(s) 378, 821
SmlI CTYRAG 2 cut(s) 535, 1112
SmoI CTYRAG 2 cut(s) 535, 1112
SsiI CCGC 2 cut(s) 95, 1403
SspI AATATT 4 cut(s) 125, 286, 345, 873
SspMI CTAG 3 cut(s) 900, 939, 1182
StyI CCWWGG 1 cut(s) 324
TaaI ACNGT 2 cut(s) 49, 1397
TaiI ACGT 1 cut(s) 197
TaqI TCGA 4 cut(s) 852, 864, 1243, 1368
TatI WGTACW 2 cut(s) 367, 976
TfiI GAWTC 1 cut(s) 1007
Tru1I TTAA 9 cut(s) 33, 288, 359, 512, 536, 591, 990, 1113, 1163
Tru9I TTAA 9 cut(s) 33, 288, 359, 512, 536, 591, 990, 1113, 1163
TscAI CASTG 1 cut(s) 309
TseFI GTSAC 1 cut(s) 1253
TseI GCWGC 1 cut(s) 1362
Tsp45I GTSAC 1 cut(s) 1253
TspDTI ATGAA 9 cut(s) 10, 243, 562, 621, 669, 731, 751, 1021, 1116
TspGWI ACGGA 1 cut(s) 517
TspRI CASTG 1 cut(s) 309
Van91I CCANNNNNTGG 2 cut(s) 444, 698
Vha464I CTTAAG 2 cut(s) 535, 1112
VpaK11BI GGWCC 2 cut(s) 331, 747
VspI ATTAAT 1 cut(s) 591
XapI RAATTY 5 cut(s) 719, 1052, 1118, 1126, 1166
XbaI TCTAGA 1 cut(s) 899
XmiI GTMKAC 1 cut(s) 407
XmnI GAANNNNTTC 1 cut(s) 722
XspI CTAG 3 cut(s) 900, 939, 1182
ZrmI AGTACT 1 cut(s) 978
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.