Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

tig00001604

Orthogroup ID

OG0000120

Physical Location & Seq

Genomic Coordinates Forward (+)

163147 .. 172602

Gene Structure 9456 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom1604g00160.3

Sequence Viewer

CDS Protein Promoter (2k)

Length: 381 bp

ATGAGTTGGCCGTTCAAGAAGTCCCTCGCACTTAGTGTTCAGTGTGCGAGTTCTGTGTCCAACATGGGCCAACGCCTGCTTGCCCGCTCCCGTCAGGTGGAATCATTGATGGCAGAGGTGGAGAGTCTTAAGCAAGAGATCCAGCAGCTTAAGTACGAGAATAGAAGTTTGCATGTGCTTGCAAATAACTATTCGTCGGGCATGAAGAGAAAGCTTGATGAGCTGCAAGAATCTGAGGGTCGAATTCACAGTGACCGTCAAAGGCTTGCGGCTTGTCTCCAGAGGCACCTTTTTCCTGGGTCATCCAACGCTTGGCCAAGTATTGAGGCCTGGAATGCTCTAGCTCCGATGGCTTCCTCCTTCTGCTTCGACGCCTCGTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004177 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005829 GO:0006508 GO:0006807 GO:0008150 GO:0008152 GO:0008233 GO:0008238 GO:0008239 GO:0016787 GO:0019538 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044238 GO:0044424 GO:0044444 GO:0044464 GO:0070011 GO:0071704 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

NUDIX Peptidase_M49

Protein Analysis

127

Amino Acids

14.2

Weight (kDa)

8.93

Isoelectric Point (pI)

67.79

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000120)

Species	Orthologous Gene IDs
malus_domestica	MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica	Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis	pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	285
AccB7I	CCANNNNNTGG	1 cut(s)	312
AccBSI	CCGCTC	1 cut(s)	87
AciI	CCGC	2 cut(s)	85, 269
AclWI	GGATC	1 cut(s)	133
AcoI	YGGCCR	2 cut(s)	8, 314
AcsI	RAATTY	1 cut(s)	243
AcyI	GRCGYC	1 cut(s)	372
AdeI	CACNNNGTG	1 cut(s)	35
AfaI	GTAC	1 cut(s)	155
AfiI	CCNNNNNNNGG	2 cut(s)	97, 312
AflII	CTTAAG	2 cut(s)	128, 149
AgsI	TTSAA	1 cut(s)	16
AjnI	CCWGG	2 cut(s)	295, 329
AluBI	AGCT	4 cut(s)	148, 214, 223, 344
AluI	AGCT	4 cut(s)	148, 214, 223, 344
Alw26I	GTCTC	1 cut(s)	281
AlwI	GGATC	1 cut(s)	133
AoxI	GGCC	4 cut(s)	8, 67, 314, 327
ApeKI	GCWGC	2 cut(s)	145, 223
ApoI	RAATTY	1 cut(s)	243
AspS9I	GGNCC	1 cut(s)	67
BalI	TGGCCA	1 cut(s)	316
BanI	GGYRCC	1 cut(s)	285
BbvI	GCAGC	2 cut(s)	157, 210
BccI	CCATC	2 cut(s)	103, 343
BciT130I	CCWGG	2 cut(s)	297, 331
BcoDI	GTCTC	1 cut(s)	281
BfaI	CTAG	1 cut(s)	341
BfrI	CTTAAG	2 cut(s)	128, 149
BisI	GCNGC	3 cut(s)	146, 224, 270
BlsI	GCNGC	3 cut(s)	147, 225, 271
Bme1390I	CCNGG	2 cut(s)	297, 331
BmgT120I	GGNCC	1 cut(s)	67
BmiI	GGNNCC	1 cut(s)	287
BmrFI	CCNGG	2 cut(s)	297, 331
BpmI	CTGGAG	1 cut(s)	263
BsaHI	GRCGYC	1 cut(s)	372
BsaJI	CCNNGG	1 cut(s)	296
Bsc4I	CCNNNNNNNGG	2 cut(s)	97, 312
BseBI	CCWGG	2 cut(s)	297, 331
BseDI	CCNNGG	1 cut(s)	296
BseGI	GGATG	1 cut(s)	302
BseLI	CCNNNNNNNGG	2 cut(s)	97, 312
BseMII	CTCAG	1 cut(s)	225
BseXI	GCAGC	2 cut(s)	157, 210
BshFI	GGCC	4 cut(s)	10, 69, 316, 329
BshNI	GGYRCC	1 cut(s)	285
BslFI	GGGAC	1 cut(s)	7
BslI	CCNNNNNNNGG	2 cut(s)	97, 312
BsmAI	GTCTC	1 cut(s)	281
BsmFI	GGGAC	1 cut(s)	7
BsmI	GAATGC	1 cut(s)	340
BsnI	GGCC	4 cut(s)	10, 69, 316, 329
Bsp143I	GATC	1 cut(s)	138
BspACI	CCGC	2 cut(s)	85, 269
BspANI	GGCC	4 cut(s)	10, 69, 316, 329
BspCNI	CTCAG	1 cut(s)	226
BspLI	GGNNCC	1 cut(s)	287
BspPI	GGATC	1 cut(s)	133
BspT107I	GGYRCC	1 cut(s)	285
BspTI	CTTAAG	2 cut(s)	128, 149
BsrBI	CCGCTC	1 cut(s)	87
BssECI	CCNNGG	1 cut(s)	296
BssMI	GATC	1 cut(s)	138
BssNI	GRCGYC	1 cut(s)	372
Bst2UI	CCWGG	2 cut(s)	297, 331
Bst4CI	ACNGT	2 cut(s)	251, 257
Bst6I	CTCTTC	1 cut(s)	200
BstACI	GRCGYC	1 cut(s)	372
BstAFI	CTTAAG	2 cut(s)	128, 149
BstC8I	GCNNGC	5 cut(s)	77, 81, 85, 180, 267
BstDEI	CTNAG	2 cut(s)	32, 234
BstF5I	GGATG	1 cut(s)	302
BstKTI	GATC	1 cut(s)	141
BstMAI	GTCTC	1 cut(s)	281
BstMBI	GATC	1 cut(s)	138
BstMWI	GCNNNNNNNGC	3 cut(s)	220, 335, 350
BstNI	CCWGG	2 cut(s)	297, 331
BstNSI	RCATGY	1 cut(s)	176
BstSCI	CCNGG	2 cut(s)	295, 329
BstV1I	GCAGC	2 cut(s)	157, 210
BstX2I	RGATCY	1 cut(s)	138
BstYI	RGATCY	1 cut(s)	138
BsuRI	GGCC	4 cut(s)	10, 69, 316, 329
BtsCI	GGATG	1 cut(s)	302
BtsIMutI	CAGTG	2 cut(s)	47, 256
Cac8I	GCNNGC	5 cut(s)	77, 81, 85, 180, 267
Cfr13I	GGNCC	1 cut(s)	67
Csp6I	GTAC	1 cut(s)	154
CviAII	CATG	3 cut(s)	64, 173, 202
CviQI	GTAC	1 cut(s)	154
DdeI	CTNAG	2 cut(s)	32, 234
DpnI	GATC	1 cut(s)	140
DpnII	GATC	1 cut(s)	138
DraIII	CACNNNGTG	1 cut(s)	35
EaeI	YGGCCR	2 cut(s)	8, 314
Eam1104I	CTCTTC	1 cut(s)	200
EarI	CTCTTC	1 cut(s)	200
Eco147I	AGGCCT	1 cut(s)	329
EcoRI	GAATTC	1 cut(s)	243
EcoRII	CCWGG	2 cut(s)	295, 329
FaeI	CATG	3 cut(s)	67, 176, 205
FaiI	YATR	3 cut(s)	65, 174, 203
FaqI	GGGAC	1 cut(s)	7
FatI	CATG	3 cut(s)	63, 172, 201
FauI	CCCGC	1 cut(s)	92
Fnu4HI	GCNGC	3 cut(s)	146, 224, 270
FokI	GGATG	1 cut(s)	289
Fsp4HI	GCNGC	3 cut(s)	146, 224, 270
FspBI	CTAG	1 cut(s)	341
GluI	GCNGC	3 cut(s)	146, 224, 270
GsuI	CTGGAG	1 cut(s)	263
HaeIII	GGCC	4 cut(s)	10, 69, 316, 329
Hin1I	GRCGYC	1 cut(s)	372
Hin1II	CATG	3 cut(s)	67, 176, 205
HindIII	AAGCTT	1 cut(s)	212
HinfI	GANTC	3 cut(s)	101, 124, 230
Hpy188I	TCNGA	2 cut(s)	235, 348
Hpy188III	TCNNGA	2 cut(s)	16, 280
Hpy99I	CGWCG	2 cut(s)	199, 374
HpyAV	CCTTC	1 cut(s)	370
HpyCH4III	ACNGT	2 cut(s)	251, 257
HpyCH4V	TGCA	3 cut(s)	172, 182, 226
HpyF10VI	GCNNNNNNNGC	3 cut(s)	220, 335, 350
HpyF3I	CTNAG	2 cut(s)	32, 234
Hsp92I	GRCGYC	1 cut(s)	372
Hsp92II	CATG	3 cut(s)	67, 176, 205
Kzo9I	GATC	1 cut(s)	138
LmnI	GCTCC	2 cut(s)	92, 349
LpnPI	CCDG	8 cut(s)	80, 89, 155, 282, 293, 309, 316, 343
Lsp1109I	GCAGC	2 cut(s)	157, 210
MaeI	CTAG	1 cut(s)	341
MaeIII	GTNAC	1 cut(s)	251
MalI	GATC	1 cut(s)	140
MbiI	CCGCTC	1 cut(s)	87
MboI	GATC	1 cut(s)	138
MboII	GAAGA	1 cut(s)	217
MflI	RGATCY	1 cut(s)	138
MlsI	TGGCCA	1 cut(s)	316
MluCI	AATT	1 cut(s)	243
MluNI	TGGCCA	1 cut(s)	316
MlyI	GAGTC	1 cut(s)	133
MmeI	TCCRAC	2 cut(s)	84, 330
MnlI	CCTC	6 cut(s)	35, 109, 229, 276, 319, 367
Mox20I	TGGCCA	1 cut(s)	316
MscI	TGGCCA	1 cut(s)	316
MseI	TTAA	2 cut(s)	129, 150
Msp20I	TGGCCA	1 cut(s)	316
MspCI	CTTAAG	2 cut(s)	128, 149
MspR9I	CCNGG	2 cut(s)	297, 331
Mva1269I	GAATGC	1 cut(s)	340
MvaI	CCWGG	2 cut(s)	297, 331
MwoI	GCNNNNNNNGC	3 cut(s)	220, 335, 350
NdeII	GATC	1 cut(s)	138
NlaIII	CATG	3 cut(s)	67, 176, 205
NlaIV	GGNNCC	1 cut(s)	287
NmuCI	GTSAC	1 cut(s)	251
NspI	RCATGY	1 cut(s)	176
PceI	AGGCCT	1 cut(s)	329
PctI	GAATGC	1 cut(s)	340
PfeI	GAWTC	2 cut(s)	101, 230
PflMI	CCANNNNNTGG	1 cut(s)	312
PkrI	GCNGC	3 cut(s)	147, 225, 271
PleI	GAGTC	1 cut(s)	132
PpsI	GAGTC	1 cut(s)	132
Psp6I	CCWGG	2 cut(s)	295, 329
PspGI	CCWGG	2 cut(s)	295, 329
PspN4I	GGNNCC	1 cut(s)	287
PspPI	GGNCC	1 cut(s)	67
PsuI	RGATCY	1 cut(s)	138
RsaI	GTAC	1 cut(s)	155
RsaNI	GTAC	1 cut(s)	154
SaqAI	TTAA	2 cut(s)	129, 150
SatI	GCNGC	3 cut(s)	146, 224, 270
Sau3AI	GATC	1 cut(s)	138
Sau96I	GGNCC	1 cut(s)	67
SchI	GAGTC	1 cut(s)	133
ScrFI	CCNGG	2 cut(s)	297, 331
SetI	ASST	7 cut(s)	99, 120, 150, 216, 225, 291, 346
SmlI	CTYRAG	2 cut(s)	128, 149
SmoI	CTYRAG	2 cut(s)	128, 149
Sse9I	AATT	1 cut(s)	243
SseBI	AGGCCT	1 cut(s)	329
SsiI	CCGC	2 cut(s)	85, 269
SspMI	CTAG	1 cut(s)	341
StuI	AGGCCT	1 cut(s)	329
StyD4I	CCNGG	2 cut(s)	295, 329
TaaI	ACNGT	2 cut(s)	251, 257
TaqI	TCGA	2 cut(s)	241, 369
TasI	AATT	1 cut(s)	243
TauI	GCSGC	1 cut(s)	272
TfiI	GAWTC	2 cut(s)	101, 230
Tru1I	TTAA	2 cut(s)	129, 150
Tru9I	TTAA	2 cut(s)	129, 150
TscAI	CASTG	2 cut(s)	47, 256
TseFI	GTSAC	1 cut(s)	251
TseI	GCWGC	2 cut(s)	145, 223
Tsp45I	GTSAC	1 cut(s)	251
TspDTI	ATGAA	1 cut(s)	218
TspRI	CASTG	2 cut(s)	47, 256
Van91I	CCANNNNNTGG	1 cut(s)	312
Vha464I	CTTAAG	2 cut(s)	128, 149
XapI	RAATTY	1 cut(s)	243
XceI	RCATGY	1 cut(s)	176
XspI	CTAG	1 cut(s)	341

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.