Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

SuperScaffold_436

Orthogroup ID

OG0000120

Physical Location & Seq

Genomic Coordinates Forward (+)

504042 .. 504864

Gene Structure 823 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom436g00430.2

Sequence Viewer

CDS Protein Promoter (2k)

Length: 771 bp

ATGGCAAACCCATCGAACCTTAGCTTAGAATTGAGTCTCAGCAGTGATACGGGCGCGCCGCGTCAAGGTAACGTATGGCGCCCTTCTTTCTTATCTTCTAACGGTCCTCTTACAGGTGAAGACTCTGTGATGCAGGACGCCACAACAGCTACAATAGTAGCTAGGAACCTCCTCACTCCAAAAGATAGTAGGCTGCTGTCAGGACGGTCTGATGAGTTGGCCGTTCAAGAGTCCCTCGCACTTAGTGTTCAGTGTGCGAGTTCTGTGTCCAACATGGGCCAACGCCTGCTTGCCCGCTCCCGTCAGGTGGAATCATTGATGGCAGAGGTGGAAAGTCTCAAGCAGGAGATCAAACTGCTTAAGCACGAGAATAGAATTTTGCACGTGCTTGCCAACAACTATTCGACGGGTATGAAGAGGAAGCTTGATGAGCTGCAAGAATCCAATGGTCGGATGCAAAGTGACCGTCCAAGTGACCGTCAAAGGCTTGCGGCTTACTTCCAGAGGCACATTTTTCCTGGCTCGTCCAGCGTTTGGCCAAGTATTGAGGCCTGGAATGCTCCTGCTCCGATGCCTTCCGCTTCTATGCCTCCCGCATCTATGCCTTCCGCTTCTATGCCTTCCACTTCTAGAATTTTGCCCAGTAGTGGGGCTTCAAGCAAACAACCTCTTTTTATTTTTATGAACATGCTTTATTTTTATGAACAAAGAGAAATCAAAGAAACACCTAAACATTCCAACAACTCAAACTTGAATTGTATGAACGTTTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004177 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005829 GO:0006508 GO:0006807 GO:0008150 GO:0008152 GO:0008233 GO:0008238 GO:0008239 GO:0016787 GO:0019538 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044238 GO:0044424 GO:0044444 GO:0044464 GO:0070011 GO:0071704 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

NUDIX Peptidase_M49

Protein Analysis

257

Amino Acids

28.23

Weight (kDa)

8.95

Isoelectric Point (pI)

61.9

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000120)

Species	Orthologous Gene IDs
malus_domestica	MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica	Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis	pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	78
AccB7I	CCANNNNNTGG	1 cut(s)	534
AccBSI	CCGCTC	1 cut(s)	297
AccII	CGCG	2 cut(s)	56, 61
AciI	CCGC	6 cut(s)	59, 295, 491, 579, 594, 609
AclI	AACGTT	1 cut(s)	765
AcoI	YGGCCR	2 cut(s)	219, 536
AcsI	RAATTY	2 cut(s)	375, 633
AcvI	CACGTG	1 cut(s)	385
AcyI	GRCGYC	2 cut(s)	79, 138
AdeI	CACNNNGTG	1 cut(s)	245
AfiI	CCNNNNNNNGG	7 cut(s)	65, 113, 307, 450, 534, 647, 648
AflII	CTTAAG	1 cut(s)	359
AgsI	TTSAA	3 cut(s)	227, 657, 754
AjnI	CCWGG	2 cut(s)	517, 551
AluBI	AGCT	5 cut(s)	24, 149, 161, 424, 433
AluI	AGCT	5 cut(s)	24, 149, 161, 424, 433
Alw26I	GTCTC	2 cut(s)	41, 341
AoxI	GGCC	4 cut(s)	219, 277, 536, 549
ApeKI	GCWGC	2 cut(s)	193, 433
ApoI	RAATTY	2 cut(s)	375, 633
ArsI	GACNNNNNNTTYG	2 cut(s)	451, 483
AscI	GGCGCGCC	1 cut(s)	54
AspLEI	GCGC	3 cut(s)	56, 58, 81
AspS9I	GGNCC	2 cut(s)	104, 277
AsuHPI	GGTGA	1 cut(s)	128
AvaII	GGWCC	1 cut(s)	104
BalI	TGGCCA	1 cut(s)	538
BanI	GGYRCC	1 cut(s)	78
BarI	GAAGNNNNNNTAC	2 cut(s)	637, 669
BauI	CACGAG	1 cut(s)	365
BbrPI	CACGTG	1 cut(s)	385
BbsI	GAAGAC	1 cut(s)	126
BbvI	GCAGC	2 cut(s)	180, 420
BccI	CCATC	2 cut(s)	19, 313
BceAI	ACGGC	1 cut(s)	206
BcgI	CGANNNNNNTGC	1 cut(s)	28
BciT130I	CCWGG	2 cut(s)	519, 553
BcoDI	GTCTC	2 cut(s)	41, 341
BfaI	CTAG	2 cut(s)	162, 630
BfoI	RGCGCY	1 cut(s)	82
BfrI	CTTAAG	1 cut(s)	359
BisI	GCNGC	4 cut(s)	59, 194, 434, 492
BlsI	GCNGC	4 cut(s)	60, 195, 435, 493
Bme1390I	CCNGG	2 cut(s)	519, 553
Bme18I	GGWCC	1 cut(s)	104
BmgT120I	GGNCC	2 cut(s)	104, 277
BmiI	GGNNCC	2 cut(s)	80, 167
BmrFI	CCNGG	2 cut(s)	519, 553
BmrI	ACTGGG	1 cut(s)	636
BmsI	GCATC	4 cut(s)	120, 444, 561, 605
BmuI	ACTGGG	1 cut(s)	636
BpiI	GAAGAC	1 cut(s)	126
Bpu10I	CCTNAGC	1 cut(s)	20
BpuEI	CTTGAG	1 cut(s)	323
BsaAI	YACGTR	1 cut(s)	385
BsaHI	GRCGYC	2 cut(s)	79, 138
Bsc4I	CCNNNNNNNGG	7 cut(s)	65, 113, 307, 450, 534, 647, 648
Bse1I	ACTGG	1 cut(s)	642
BseBI	CCWGG	2 cut(s)	519, 553
BseGI	GGATG	1 cut(s)	459
BseLI	CCNNNNNNNGG	7 cut(s)	65, 113, 307, 450, 534, 647, 648
BseMII	CTCAG	1 cut(s)	52
BseNI	ACTGG	1 cut(s)	642
BsePI	GCGCGC	1 cut(s)	54
BseRI	GAGGAG	1 cut(s)	161
BseXI	GCAGC	2 cut(s)	180, 420
Bsh1236I	CGCG	2 cut(s)	56, 61
BshFI	GGCC	4 cut(s)	221, 279, 538, 551
BshNI	GGYRCC	1 cut(s)	78
BslFI	GGGAC	1 cut(s)	217
BslI	CCNNNNNNNGG	7 cut(s)	65, 113, 307, 450, 534, 647, 648
BsmAI	GTCTC	2 cut(s)	41, 341
BsmFI	GGGAC	1 cut(s)	217
BsmI	GAATGC	1 cut(s)	562
BsnI	GGCC	4 cut(s)	221, 279, 538, 551
Bsp143I	GATC	1 cut(s)	348
BspACI	CCGC	6 cut(s)	59, 295, 491, 579, 594, 609
BspANI	GGCC	4 cut(s)	221, 279, 538, 551
BspCNI	CTCAG	1 cut(s)	51
BspFNI	CGCG	2 cut(s)	56, 61
BspLI	GGNNCC	2 cut(s)	80, 167
BspT107I	GGYRCC	1 cut(s)	78
BspTI	CTTAAG	1 cut(s)	359
BsrBI	CCGCTC	1 cut(s)	297
BsrI	ACTGG	1 cut(s)	642
BssHII	GCGCGC	1 cut(s)	54
BssMI	GATC	1 cut(s)	348
BssNI	GRCGYC	2 cut(s)	79, 138
BssSI	CACGAG	1 cut(s)	365
Bst2BI	CACGAG	1 cut(s)	365
Bst2UI	CCWGG	2 cut(s)	519, 553
Bst4CI	ACNGT	4 cut(s)	104, 207, 467, 479
Bst6I	CTCTTC	1 cut(s)	410
BstACI	GRCGYC	2 cut(s)	79, 138
BstAFI	CTTAAG	1 cut(s)	359
BstBAI	YACGTR	1 cut(s)	385
BstC8I	GCNNGC	6 cut(s)	56, 287, 291, 295, 390, 489
BstDEI	CTNAG	4 cut(s)	20, 25, 38, 242
BstENI	CCTNNNNNAGG	1 cut(s)	111
BstF5I	GGATG	1 cut(s)	459
BstFNI	CGCG	2 cut(s)	56, 61
BstH2I	RGCGCY	1 cut(s)	82
BstHHI	GCGC	3 cut(s)	56, 58, 81
BstKTI	GATC	1 cut(s)	351
BstMAI	GTCTC	2 cut(s)	41, 341
BstMBI	GATC	1 cut(s)	348
BstMWI	GCNNNNNNNGC	4 cut(s)	146, 430, 528, 557
BstNI	CCWGG	2 cut(s)	519, 553
BstNSI	RCATGY	1 cut(s)	691
BstSCI	CCNGG	2 cut(s)	517, 551
BstUI	CGCG	2 cut(s)	56, 61
BstV1I	GCAGC	2 cut(s)	180, 420
BstV2I	GAAGAC	1 cut(s)	126
BsuRI	GGCC	4 cut(s)	221, 279, 538, 551
BtsCI	GGATG	1 cut(s)	459
BtsI	GCAGTG	1 cut(s)	49
BtsIMutI	CAGTG	2 cut(s)	49, 257
Cac8I	GCNNGC	6 cut(s)	56, 287, 291, 295, 390, 489
CfoI	GCGC	3 cut(s)	56, 58, 81
Cfr13I	GGNCC	2 cut(s)	104, 277
CseI	GACGC	2 cut(s)	50, 146
CviAII	CATG	2 cut(s)	274, 688
DdeI	CTNAG	4 cut(s)	20, 25, 38, 242
DinI	GGCGCC	1 cut(s)	80
DpnI	GATC	1 cut(s)	350
DpnII	GATC	1 cut(s)	348
DraIII	CACNNNGTG	1 cut(s)	245
EaeI	YGGCCR	2 cut(s)	219, 536
Eam1104I	CTCTTC	1 cut(s)	410
EarI	CTCTTC	1 cut(s)	410
Eco147I	AGGCCT	1 cut(s)	551
Eco47I	GGWCC	1 cut(s)	104
Eco72I	CACGTG	1 cut(s)	385
EcoNI	CCTNNNNNAGG	1 cut(s)	111
EcoRII	CCWGG	2 cut(s)	517, 551
EgeI	GGCGCC	1 cut(s)	80
EheI	GGCGCC	1 cut(s)	80
FaeI	CATG	2 cut(s)	277, 691
FaqI	GGGAC	1 cut(s)	217
FatI	CATG	2 cut(s)	273, 687
FauI	CCCGC	2 cut(s)	302, 601
Fnu4HI	GCNGC	4 cut(s)	59, 194, 434, 492
FokI	GGATG	1 cut(s)	466
Fsp4HI	GCNGC	4 cut(s)	59, 194, 434, 492
FspBI	CTAG	2 cut(s)	162, 630
GlaI	GCGC	3 cut(s)	55, 57, 80
GluI	GCNGC	4 cut(s)	59, 194, 434, 492
HaeII	RGCGCY	1 cut(s)	82
HaeIII	GGCC	4 cut(s)	221, 279, 538, 551
HgaI	GACGC	2 cut(s)	50, 146
HhaI	GCGC	3 cut(s)	56, 58, 81
Hin1I	GRCGYC	2 cut(s)	79, 138
Hin1II	CATG	2 cut(s)	277, 691
Hin6I	GCGC	3 cut(s)	54, 56, 79
HinP1I	GCGC	3 cut(s)	54, 56, 79
HindIII	AAGCTT	1 cut(s)	422
HinfI	GANTC	5 cut(s)	34, 122, 230, 311, 440
HphI	GGTGA	1 cut(s)	128
Hpy188I	TCNGA	3 cut(s)	211, 453, 570
Hpy188III	TCNNGA	4 cut(s)	201, 227, 502, 630
Hpy99I	CGWCG	1 cut(s)	409
HpyAV	CCTTC	4 cut(s)	93, 585, 615, 630
HpyCH4III	ACNGT	4 cut(s)	104, 207, 467, 479
HpyCH4IV	ACGT	3 cut(s)	72, 384, 765
HpyCH4V	TGCA	4 cut(s)	133, 382, 436, 457
HpyF10VI	GCNNNNNNNGC	4 cut(s)	146, 430, 528, 557
HpyF3I	CTNAG	4 cut(s)	20, 25, 38, 242
HpySE526I	ACGT	3 cut(s)	72, 384, 765
Hsp92I	GRCGYC	2 cut(s)	79, 138
Hsp92II	CATG	2 cut(s)	277, 691
HspAI	GCGC	3 cut(s)	54, 56, 79
KasI	GGCGCC	1 cut(s)	78
Kzo9I	GATC	1 cut(s)	348
LmnI	GCTCC	3 cut(s)	302, 565, 571
Lsp1109I	GCAGC	2 cut(s)	180, 420
LweI	GCATC	4 cut(s)	120, 444, 561, 605
MaeI	CTAG	2 cut(s)	162, 630
MaeII	ACGT	3 cut(s)	72, 384, 765
MaeIII	GTNAC	3 cut(s)	68, 461, 473
MalI	GATC	1 cut(s)	350
MbiI	CCGCTC	1 cut(s)	297
MboI	GATC	1 cut(s)	348
MboII	GAAGA	3 cut(s)	87, 131, 427
MlsI	TGGCCA	1 cut(s)	538
MluCI	AATT	4 cut(s)	29, 375, 633, 754
MluNI	TGGCCA	1 cut(s)	538
Mly113I	GGCGCC	1 cut(s)	79
MlyI	GAGTC	3 cut(s)	43, 116, 239
MmeI	TCCRAC	3 cut(s)	294, 431, 762
Mox20I	TGGCCA	1 cut(s)	538
MscI	TGGCCA	1 cut(s)	538
MseI	TTAA	1 cut(s)	360
Msp20I	TGGCCA	1 cut(s)	538
MspCI	CTTAAG	1 cut(s)	359
MspR9I	CCNGG	2 cut(s)	519, 553
Mva1269I	GAATGC	1 cut(s)	562
MvaI	CCWGG	2 cut(s)	519, 553
MvnI	CGCG	2 cut(s)	56, 61
MwoI	GCNNNNNNNGC	4 cut(s)	146, 430, 528, 557
NarI	GGCGCC	1 cut(s)	79
NdeII	GATC	1 cut(s)	348
NlaIII	CATG	2 cut(s)	277, 691
NlaIV	GGNNCC	2 cut(s)	80, 167
NmuCI	GTSAC	2 cut(s)	461, 473
NspI	RCATGY	1 cut(s)	691
PalAI	GGCGCGCC	1 cut(s)	54
PauI	GCGCGC	1 cut(s)	54
PceI	AGGCCT	1 cut(s)	551
PctI	GAATGC	1 cut(s)	562
PfeI	GAWTC	2 cut(s)	311, 440
PflMI	CCANNNNNTGG	1 cut(s)	534
PkrI	GCNGC	4 cut(s)	60, 195, 435, 493
PleI	GAGTC	3 cut(s)	42, 116, 238
PluTI	GGCGCC	1 cut(s)	82
PmaCI	CACGTG	1 cut(s)	385
PmlI	CACGTG	1 cut(s)	385
PpsI	GAGTC	3 cut(s)	42, 116, 238
Ppu21I	YACGTR	1 cut(s)	385
Psp1406I	AACGTT	1 cut(s)	765
Psp6I	CCWGG	2 cut(s)	517, 551
PspCI	CACGTG	1 cut(s)	385
PspGI	CCWGG	2 cut(s)	517, 551
PspN4I	GGNNCC	2 cut(s)	80, 167
PspPI	GGNCC	2 cut(s)	104, 277
PteI	GCGCGC	1 cut(s)	54
SaqAI	TTAA	1 cut(s)	360
SatI	GCNGC	4 cut(s)	59, 194, 434, 492
Sau3AI	GATC	1 cut(s)	348
Sau96I	GGNCC	2 cut(s)	104, 277
SchI	GAGTC	3 cut(s)	43, 116, 239
ScrFI	CCNGG	2 cut(s)	519, 553
SfaNI	GCATC	4 cut(s)	120, 444, 561, 605
SfoI	GGCGCC	1 cut(s)	80
SgsI	GGCGCGCC	1 cut(s)	54
SinI	GGWCC	1 cut(s)	104
SmlI	CTYRAG	2 cut(s)	338, 359
SmoI	CTYRAG	2 cut(s)	338, 359
Sse9I	AATT	4 cut(s)	29, 375, 633, 754
SseBI	AGGCCT	1 cut(s)	551
SsiI	CCGC	6 cut(s)	59, 295, 491, 579, 594, 609
SspDI	GGCGCC	1 cut(s)	78
SspMI	CTAG	2 cut(s)	162, 630
StuI	AGGCCT	1 cut(s)	551
StyD4I	CCNGG	2 cut(s)	517, 551
TaaI	ACNGT	4 cut(s)	104, 207, 467, 479
TaiI	ACGT	3 cut(s)	75, 387, 768
TaqI	TCGA	2 cut(s)	14, 404
TasI	AATT	4 cut(s)	29, 375, 633, 754
TauI	GCSGC	2 cut(s)	61, 494
TfiI	GAWTC	2 cut(s)	311, 440
Tru1I	TTAA	1 cut(s)	360
Tru9I	TTAA	1 cut(s)	360
TscAI	CASTG	2 cut(s)	49, 257
TseFI	GTSAC	2 cut(s)	461, 473
TseI	GCWGC	2 cut(s)	193, 433
Tsp45I	GTSAC	2 cut(s)	461, 473
TspDTI	ATGAA	3 cut(s)	428, 698, 717
TspRI	CASTG	2 cut(s)	49, 257
Van91I	CCANNNNNTGG	1 cut(s)	534
Vha464I	CTTAAG	1 cut(s)	359
VpaK11BI	GGWCC	1 cut(s)	104
XagI	CCTNNNNNAGG	1 cut(s)	111
XapI	RAATTY	2 cut(s)	375, 633
XbaI	TCTAGA	1 cut(s)	629
XceI	RCATGY	1 cut(s)	691
XspI	CTAG	2 cut(s)	162, 630

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.