pycom01g00740

Zinc finger MYM-type protein 1-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr1
OG0000120
Physical Location & Seq
Forward (+)
731414 .. 733446
2033 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom01g00740.5

Sequence Viewer

Length: 1542 bp
ATGGAATATCATGAATTCATCAAAGAGGACGTTCTTTATGACACAGGACAAGGAAGAATCCTCATACCAAATCTGTCCAAGGGCAAAGTTCCTGAAACGTTCAAGGAAGATGTGTTTATTCTTGAGTTCATGTTGGAGCACACAGGTAAGCCGCCTCCCCGAATTTCAATTTTCTTTTATACTAATATGTTGTTAATGATTCAGGCACCCAATCTTGAATTTAAACTATTACTGGATCATTTCAAGTATCACCTTCCATTCAAAGATAAATTCCATGCCAAAATAAAGATAGGCCGGAGCCTTCACAAAGGTCGTTTACGTGAAGCCCCACTACTTGGCAAAACTCCAGGAGCGGGAGACGTCGAAGATGGATCATTCGAGGTGCCTCTGGAAGAAAGCCGCAAACCTTTGACGATCACTTTGACGGTCACTTTGAATTCGACCATTAGATTCTTGCAGCTCATCAAGCTTCCTCTTCATGCTAGTCGAATAGTTATTTGCAAGCACATGCAAACTTCTATTCTCATGCTTAAGCTGTTTGATCTCTCGCTTAAGACTTTCCACCTCCGCCATCAAGGATTCAACTTGGCGGGATCGACGGACCGTCCTGAAAGCAGCCTACTATCTTTAGGGGTGAGGAGGTTCATAGCTACTATCGTAGCTGTTGTTGCATCCGTCATCATGGAGTCTTCACCTGTAAGAGGGCCATTAGAAGATAAGAAAGAAGGACTCAAATCTAAGCAAAGGTTAGATGGGTTAGCCATTTTTCAAAAATACGATTATCAAGAATGGGCAATCTTCAAAGTGTGCATGTTGGAGGTGATCGATACCTCTATAAAAAGCCAAGGCGACATGACCACCAATTCAAAAAGCCGGATTTTCCTGCGTAAAGTTCGGCGATGCTCTCTCGGCTTTTCAGAAAACGCGTTCAACTTTGTCAAAAGATCTCTGACAAAGTTGAAAACACGTGGAGGTCATCATCGCAACTACACACTTTTGCCGACAAGCGTAAAGTTCGGCGACGCTTTCTCTGCTTTTCAGAAAACGCGTGCAACTTTGTCAAAAGATGTCTTTATACCATCTCACAATGGAGTGGCAAACTTGCAATTAAGCCAAGTTCACTACCCTCCTCTAAATGGCCGGCCTAAGGGGATTTATTGGGCTATTTGGGCCTTTGGACTTGACGTTCGAAGCCCATTGGGCCTTAAGGTCCAAAACTATCCCGAGGTCTTTAACGAACTTATTCTATTCTTACTCATCTTCGTTGAATCTTCAATCTCTACCTTACACGTCAAACTCTTTCAAATCGATTTTGAATTGAAACTTACTTTCAATTCTCCCGTTAGTGATAATACACTTTTAGGGCTTCCACAAACCATGAAGAGGTGGAGAACCTATTCAGTTTTAGGATTACAAATTGTTTGGTTTGATAGTTTATTCATGTCTACTATCCAATGTGAGTCTTGTGCTTATATGATTACCTTGAATGTGATTTGGAACACATTCCTAAATCTCATTCATACTTTGGCCAAAGATTCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4371 Dimer_Tnp_hAT

Protein Analysis

514

Amino Acids

58.65

Weight (kDa)

9.58

Isoelectric Point (pI)

36.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 363
AccB1I GGYRCC 2 cut(s) 205, 382
AccB7I CCANNNNNTGG 1 cut(s) 335
AccBSI CCGCTC 1 cut(s) 353
AccI GTMKAC 1 cut(s) 1445
AccII CGCG 2 cut(s) 926, 1048
AciI CCGC 5 cut(s) 152, 353, 400, 568, 590
AclI AACGTT 1 cut(s) 98
AclWI GGATC 3 cut(s) 243, 379, 601
AcoI YGGCCR 2 cut(s) 1138, 1527
AcsI RAATTY 5 cut(s) 14, 162, 218, 269, 436
AcvI CACGTG 1 cut(s) 968
AcyI GRCGYC 1 cut(s) 360
AfiI CCNNNNNNNGG 6 cut(s) 335, 353, 701, 1136, 1147, 1383
AflII CTTAAG 3 cut(s) 530, 551, 1205
AflIII ACRYGT 4 cut(s) 924, 965, 1046, 1288
AhdI GACNNNNNGTC 1 cut(s) 603
AjiI CACGTC 1 cut(s) 1291
AjnI CCWGG 1 cut(s) 346
AloI GAACNNNNNNTCC 2 cut(s) 1170, 1202
AluBI AGCT 5 cut(s) 460, 469, 535, 650, 662
AluI AGCT 5 cut(s) 460, 469, 535, 650, 662
Alw21I GWGCWC 1 cut(s) 141
Alw26I GTCTC 1 cut(s) 351
AlwI GGATC 3 cut(s) 243, 379, 601
Ama87I CYCGRG 1 cut(s) 1223
AoxI GGCC 7 cut(s) 292, 704, 1138, 1142, 1170, 1201, 1527
ApeKI GCWGC 2 cut(s) 457, 615
ApoI RAATTY 5 cut(s) 14, 162, 218, 269, 436
ArsI GACNNNNNNTTYG 6 cut(s) 403, 415, 435, 447, 1170, 1202
Asp700I GAANNNNTTC 3 cut(s) 1242, 1396, 1502
AspS9I GGNCC 5 cut(s) 601, 704, 1170, 1201, 1210
AsuHPI GGTGA 4 cut(s) 242, 646, 684, 832
AsuII TTCGAA 1 cut(s) 1189
AvaI CYCGRG 1 cut(s) 1223
AvaII GGWCC 2 cut(s) 601, 1210
AxyI CCTNAGG 1 cut(s) 1146
BalI TGGCCA 1 cut(s) 1529
BanI GGYRCC 2 cut(s) 205, 382
BarI GAAGNNNNNNTAC 2 cut(s) 315, 347
BbrPI CACGTG 1 cut(s) 968
BbsI GAAGAC 1 cut(s) 681
Bbv12I GWGCWC 1 cut(s) 141
BbvI GCAGC 2 cut(s) 469, 627
BccI CCATC 4 cut(s) 362, 579, 746, 1087
BciT130I CCWGG 1 cut(s) 348
BcoDI GTCTC 1 cut(s) 351
BfaI CTAG 1 cut(s) 483
BfrI CTTAAG 3 cut(s) 530, 551, 1205
BglI GCCNNNNNGGC 1 cut(s) 1200
BglII AGATCT 1 cut(s) 944
BisI GCNGC 4 cut(s) 152, 400, 458, 616
BlsI GCNGC 4 cut(s) 153, 401, 459, 617
Bme1390I CCNGG 1 cut(s) 348
Bme18I GGWCC 2 cut(s) 601, 1210
BmeRI GACNNNNNGTC 1 cut(s) 603
BmeT110I CYCGRG 1 cut(s) 1223
BmgBI CACGTC 1 cut(s) 1291
BmgT120I GGNCC 5 cut(s) 601, 704, 1170, 1201, 1210
BmiI GGNNCC 3 cut(s) 207, 299, 384
BmrFI CCNGG 1 cut(s) 348
BmsI GCATC 2 cut(s) 680, 890
BpiI GAAGAC 1 cut(s) 681
BpmI CTGGAG 1 cut(s) 330
Bpu14I TTCGAA 1 cut(s) 1189
BpuEI CTTGAG 1 cut(s) 143
Bsa29I ATCGAT 2 cut(s) 825, 1308
BsaAI YACGTR 2 cut(s) 320, 968
BsaHI GRCGYC 1 cut(s) 360
BsaJI CCNNGG 3 cut(s) 78, 844, 1224
Bsc4I CCNNNNNNNGG 6 cut(s) 335, 353, 701, 1136, 1147, 1383
Bse118I RCCGGY 1 cut(s) 1140
Bse1I ACTGG 1 cut(s) 237
Bse21I CCTNAGG 1 cut(s) 1146
BseBI CCWGG 1 cut(s) 348
BseCI ATCGAT 2 cut(s) 825, 1308
BseDI CCNNGG 3 cut(s) 78, 844, 1224
BseGI GGATG 1 cut(s) 671
BseLI CCNNNNNNNGG 6 cut(s) 335, 353, 701, 1136, 1147, 1383
BseNI ACTGG 1 cut(s) 237
BseRI GAGGAG 2 cut(s) 652, 1119
BseXI GCAGC 2 cut(s) 469, 627
Bsh1236I CGCG 2 cut(s) 926, 1048
BshFI GGCC 7 cut(s) 294, 706, 1140, 1144, 1172, 1203, 1529
BshNI GGYRCC 2 cut(s) 205, 382
BshVI ATCGAT 2 cut(s) 825, 1308
BsiHKAI GWGCWC 1 cut(s) 141
BsiHKCI CYCGRG 1 cut(s) 1223
BsiSI CCGG 3 cut(s) 295, 874, 1141
BslI CCNNNNNNNGG 6 cut(s) 335, 353, 701, 1136, 1147, 1383
BsmAI GTCTC 1 cut(s) 351
BsmBI CGTCTC 1 cut(s) 351
BsnI GGCC 7 cut(s) 294, 706, 1140, 1144, 1172, 1203, 1529
BsoBI CYCGRG 1 cut(s) 1223
Bsp119I TTCGAA 1 cut(s) 1189
Bsp1286I GDGCHC 1 cut(s) 141
Bsp143I GATC 7 cut(s) 235, 371, 414, 541, 593, 822, 944
BspACI CCGC 5 cut(s) 152, 353, 400, 568, 590
BspANI GGCC 7 cut(s) 294, 706, 1140, 1144, 1172, 1203, 1529
BspDI ATCGAT 2 cut(s) 825, 1308
BspFNI CGCG 2 cut(s) 926, 1048
BspHI TCATGA 1 cut(s) 10
BspLI GGNNCC 3 cut(s) 207, 299, 384
BspPI GGATC 3 cut(s) 243, 379, 601
BspT104I TTCGAA 1 cut(s) 1189
BspT107I GGYRCC 2 cut(s) 205, 382
BspTI CTTAAG 3 cut(s) 530, 551, 1205
BsrBI CCGCTC 1 cut(s) 353
BsrFI RCCGGY 1 cut(s) 1140
BsrI ACTGG 1 cut(s) 237
BssAI RCCGGY 1 cut(s) 1140
BssECI CCNNGG 3 cut(s) 78, 844, 1224
BssMI GATC 7 cut(s) 235, 371, 414, 541, 593, 822, 944
BssNI GRCGYC 1 cut(s) 360
BssT1I CCWWGG 2 cut(s) 78, 844
Bst2UI CCWGG 1 cut(s) 348
Bst4CI ACNGT 2 cut(s) 427, 605
Bst6I CTCTTC 2 cut(s) 480, 1376
BstACI GRCGYC 1 cut(s) 360
BstAFI CTTAAG 3 cut(s) 530, 551, 1205
BstBAI YACGTR 2 cut(s) 320, 968
BstBI TTCGAA 1 cut(s) 1189
BstC8I GCNNGC 3 cut(s) 503, 1050, 1142
BstDEI CTNAG 2 cut(s) 738, 1146
BstENI CCTNNNNNAGG 1 cut(s) 699
BstF5I GGATG 1 cut(s) 671
BstFNI CGCG 2 cut(s) 926, 1048
BstKTI GATC 7 cut(s) 238, 374, 417, 544, 596, 825, 947
BstMAI GTCTC 1 cut(s) 351
BstMBI GATC 7 cut(s) 235, 371, 414, 541, 593, 822, 944
BstMWI GCNNNNNNNGC 6 cut(s) 466, 668, 909, 1031, 1169, 1200
BstNI CCWGG 1 cut(s) 348
BstNSI RCATGY 2 cut(s) 511, 814
BstSCI CCNGG 1 cut(s) 346
BstUI CGCG 2 cut(s) 926, 1048
BstV1I GCAGC 2 cut(s) 469, 627
BstV2I GAAGAC 1 cut(s) 681
BstX2I RGATCY 1 cut(s) 944
BstYI RGATCY 1 cut(s) 944
Bsu15I ATCGAT 2 cut(s) 825, 1308
Bsu36I CCTNAGG 1 cut(s) 1146
BsuRI GGCC 7 cut(s) 294, 706, 1140, 1144, 1172, 1203, 1529
BsuTUI ATCGAT 2 cut(s) 825, 1308
BtgZI GCGATG 2 cut(s) 913, 965
BtrI CACGTC 1 cut(s) 1291
BtsCI GGATG 1 cut(s) 671
Cac8I GCNNGC 3 cut(s) 503, 1050, 1142
CciI TCATGA 1 cut(s) 10
Cfr10I RCCGGY 1 cut(s) 1140
Cfr13I GGNCC 5 cut(s) 601, 704, 1170, 1201, 1210
ClaI ATCGAT 2 cut(s) 825, 1308
CpoI CGGWCCG 1 cut(s) 601
CseI GACGC 1 cut(s) 1031
CspI CGGWCCG 1 cut(s) 601
DdeI CTNAG 2 cut(s) 738, 1146
DpnI GATC 7 cut(s) 237, 373, 416, 543, 595, 824, 946
DpnII GATC 7 cut(s) 235, 371, 414, 541, 593, 822, 944
DraI TTTAAA 1 cut(s) 223
DriI GACNNNNNGTC 1 cut(s) 603
EaeI YGGCCR 2 cut(s) 1138, 1527
Eam1104I CTCTTC 2 cut(s) 480, 1376
Eam1105I GACNNNNNGTC 1 cut(s) 603
EarI CTCTTC 2 cut(s) 480, 1376
EciI GGCGGA 1 cut(s) 557
Eco130I CCWWGG 2 cut(s) 78, 844
Eco47I GGWCC 2 cut(s) 601, 1210
Eco72I CACGTG 1 cut(s) 968
Eco81I CCTNAGG 1 cut(s) 1146
Eco88I CYCGRG 1 cut(s) 1223
EcoNI CCTNNNNNAGG 1 cut(s) 699
EcoRI GAATTC 2 cut(s) 14, 436
EcoRII CCWGG 1 cut(s) 346
EcoT14I CCWWGG 2 cut(s) 78, 844
ErhI CCWWGG 2 cut(s) 78, 844
Esp3I CGTCTC 1 cut(s) 351
FauI CCCGC 2 cut(s) 346, 583
FblI GTMKAC 1 cut(s) 1445
Fnu4HI GCNGC 4 cut(s) 152, 400, 458, 616
FokI GGATG 1 cut(s) 658
FseI GGCCGGCC 1 cut(s) 1144
Fsp4HI GCNGC 4 cut(s) 152, 400, 458, 616
FspBI CTAG 1 cut(s) 483
GluI GCNGC 4 cut(s) 152, 400, 458, 616
GsuI CTGGAG 1 cut(s) 330
HaeIII GGCC 7 cut(s) 294, 706, 1140, 1144, 1172, 1203, 1529
HapII CCGG 3 cut(s) 295, 874, 1141
HgaI GACGC 1 cut(s) 1031
Hin1I GRCGYC 1 cut(s) 360
HindIII AAGCTT 1 cut(s) 467
HinfI GANTC 9 cut(s) 57, 199, 450, 579, 686, 729, 1268, 1460, 1535
HpaII CCGG 3 cut(s) 295, 874, 1141
HphI GGTGA 4 cut(s) 242, 646, 684, 832
Hpy166II GTNNAC 3 cut(s) 317, 1120, 1446
Hpy188I TCNGA 3 cut(s) 919, 951, 1041
Hpy188III TCNNGA 8 cut(s) 11, 92, 122, 215, 389, 608, 785, 1223
Hpy8I GTNNAC 3 cut(s) 317, 1120, 1446
Hpy99I CGWCG 3 cut(s) 365, 601, 1025
HpyAV CCTTC 3 cut(s) 263, 311, 719
HpyCH4III ACNGT 2 cut(s) 427, 605
HpyCH4IV ACGT 7 cut(s) 30, 98, 319, 360, 967, 1185, 1290
HpyCH4V TGCA 7 cut(s) 457, 501, 511, 671, 810, 1052, 1105
HpyF10VI GCNNNNNNNGC 6 cut(s) 466, 668, 909, 1031, 1169, 1200
HpyF3I CTNAG 2 cut(s) 738, 1146
HpySE526I ACGT 7 cut(s) 30, 98, 319, 360, 967, 1185, 1290
Hsp92I GRCGYC 1 cut(s) 360
KroI GCCGGC 1 cut(s) 1140
KroNI GCCGGC 1 cut(s) 1142
Kzo9I GATC 7 cut(s) 235, 371, 414, 541, 593, 822, 944
LmnI GCTCC 3 cut(s) 136, 297, 350
Lsp1109I GCAGC 2 cut(s) 469, 627
LweI GCATC 2 cut(s) 680, 890
MaeI CTAG 1 cut(s) 483
MaeII ACGT 7 cut(s) 30, 98, 319, 360, 967, 1185, 1290
MaeIII GTNAC 1 cut(s) 427
MalI GATC 7 cut(s) 237, 373, 416, 543, 595, 824, 946
MbiI CCGCTC 1 cut(s) 353
MboI GATC 7 cut(s) 235, 371, 414, 541, 593, 822, 944
MflI RGATCY 1 cut(s) 944
MhlI GDGCHC 1 cut(s) 141
MlsI TGGCCA 1 cut(s) 1529
MluI ACGCGT 2 cut(s) 924, 1046
MluNI TGGCCA 1 cut(s) 1529
MlyI GAGTC 3 cut(s) 695, 723, 1469
MmeI TCCRAC 2 cut(s) 114, 795
Mox20I TGGCCA 1 cut(s) 1529
MroNI GCCGGC 1 cut(s) 1140
MroXI GAANNNNTTC 3 cut(s) 1242, 1396, 1502
MscI TGGCCA 1 cut(s) 1529
MseI TTAA 8 cut(s) 194, 222, 531, 552, 1109, 1206, 1233, 1540
Msp20I TGGCCA 1 cut(s) 1529
MspCI CTTAAG 3 cut(s) 530, 551, 1205
MspI CCGG 3 cut(s) 295, 874, 1141
MspR9I CCNGG 1 cut(s) 348
MvaI CCWGG 1 cut(s) 348
MvnI CGCG 2 cut(s) 926, 1048
MwoI GCNNNNNNNGC 6 cut(s) 466, 668, 909, 1031, 1169, 1200
NaeI GCCGGC 1 cut(s) 1142
NdeII GATC 7 cut(s) 235, 371, 414, 541, 593, 822, 944
NgoMIV GCCGGC 1 cut(s) 1140
NlaIV GGNNCC 3 cut(s) 207, 299, 384
NmeAIII GCCGAG 1 cut(s) 888
NmuCI GTSAC 1 cut(s) 427
NspI RCATGY 2 cut(s) 511, 814
NspV TTCGAA 1 cut(s) 1189
PagI TCATGA 1 cut(s) 10
PdiI GCCGGC 1 cut(s) 1142
PdmI GAANNNNTTC 3 cut(s) 1242, 1396, 1502
PfeI GAWTC 6 cut(s) 57, 199, 450, 579, 1268, 1535
PflMI CCANNNNNTGG 1 cut(s) 335
PfoI TCCNGGA 1 cut(s) 346
PkrI GCNGC 4 cut(s) 153, 401, 459, 617
PleI GAGTC 3 cut(s) 694, 723, 1468
PmaCI CACGTG 1 cut(s) 968
PmlI CACGTG 1 cut(s) 968
PpsI GAGTC 3 cut(s) 694, 723, 1468
Ppu21I YACGTR 2 cut(s) 320, 968
Psp1406I AACGTT 1 cut(s) 98
Psp6I CCWGG 1 cut(s) 346
PspCI CACGTG 1 cut(s) 968
PspGI CCWGG 1 cut(s) 346
PspN4I GGNNCC 3 cut(s) 207, 299, 384
PspPI GGNCC 5 cut(s) 601, 704, 1170, 1201, 1210
PsuI RGATCY 1 cut(s) 944
RigI GGCCGGCC 1 cut(s) 1144
Rsr2I CGGWCCG 1 cut(s) 601
RsrII CGGWCCG 1 cut(s) 601
SaqAI TTAA 8 cut(s) 194, 222, 531, 552, 1109, 1206, 1233, 1540
SatI GCNGC 4 cut(s) 152, 400, 458, 616
Sau3AI GATC 7 cut(s) 235, 371, 414, 541, 593, 822, 944
Sau96I GGNCC 5 cut(s) 601, 704, 1170, 1201, 1210
SchI GAGTC 3 cut(s) 695, 723, 1469
ScrFI CCNGG 1 cut(s) 348
SduI GDGCHC 1 cut(s) 141
SfaNI GCATC 2 cut(s) 680, 890
SfuI TTCGAA 1 cut(s) 1189
SinI GGWCC 2 cut(s) 601, 1210
SmlI CTYRAG 4 cut(s) 122, 530, 551, 1205
SmoI CTYRAG 4 cut(s) 122, 530, 551, 1205
SsiI CCGC 5 cut(s) 152, 353, 400, 568, 590
SspMI CTAG 1 cut(s) 483
StyD4I CCNGG 1 cut(s) 346
StyI CCWWGG 2 cut(s) 78, 844
TaaI ACNGT 2 cut(s) 427, 605
TaiI ACGT 7 cut(s) 33, 101, 322, 363, 970, 1188, 1293
TaqI TCGA 8 cut(s) 363, 378, 440, 487, 596, 825, 1189, 1308
TauI GCSGC 2 cut(s) 154, 402
TfiI GAWTC 6 cut(s) 57, 199, 450, 579, 1268, 1535
Tru1I TTAA 8 cut(s) 194, 222, 531, 552, 1109, 1206, 1233, 1540
Tru9I TTAA 8 cut(s) 194, 222, 531, 552, 1109, 1206, 1233, 1540
TseFI GTSAC 1 cut(s) 427
TseI GCWGC 2 cut(s) 457, 615
Tsp45I GTSAC 1 cut(s) 427
TspDTI ATGAA 8 cut(s) 7, 27, 118, 467, 634, 1394, 1429, 1508
TspGWI ACGGA 2 cut(s) 614, 664
Van91I CCANNNNNTGG 1 cut(s) 335
Vha464I CTTAAG 3 cut(s) 530, 551, 1205
VpaK11BI GGWCC 2 cut(s) 601, 1210
XagI CCTNNNNNAGG 1 cut(s) 699
XapI RAATTY 5 cut(s) 14, 162, 218, 269, 436
XceI RCATGY 2 cut(s) 511, 814
XmiI GTMKAC 1 cut(s) 1445
XmnI GAANNNNTTC 3 cut(s) 1242, 1396, 1502
XspI CTAG 1 cut(s) 483
ZraI GACGTC 1 cut(s) 361
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.