Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr5

Orthogroup ID

OG0000120

Physical Location & Seq

Genomic Coordinates Forward (+)

219895 .. 222100

Gene Structure 2206 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom05g00180.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 375 bp

ATGACTAACTCATCGAACCTTTGCTTAGATTTGAGTCTCAGCAGCGATCCGGTTGTGCCCCGTCAAGGTAATGTATGGCGCCCTTCTTTTTTATCTTCTAACGGTCCTCTTACAGGTGAAGACTCTGTGATGAAGGACGCAACAACAGCTACGATAGTAGCTAGGAACCTCCTCACTCCTGAAGATAGTCGGCTGCTTTCAGGACGGTCCGATGAGTTGGCCGTTCAAGAGTCCCTCGCTCTTAGTGTTCAGTGCGCAGGCTCTGTGTCCAACATGGGCCAACGCCTACTTGCTCGCTCCCGCCAAGTTGAATCCTTGATGGCGGAGGTGGAAAGTTGGGTTCCTCTTCCCTACTTGTTCAAACGTGCAGAGTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000160 GO:0003674 GO:0003676 GO:0003677 GO:0003700 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0006355 GO:0007154 GO:0007165 GO:0008150 GO:0009719 GO:0009723 GO:0009725 GO:0009755 GO:0009787 GO:0009789 GO:0009873 GO:0009889 GO:0009891 GO:0009893 GO:0009966 GO:0009967 GO:0009987 GO:0010033 GO:0010118 GO:0010185 GO:0010186 GO:0010200 GO:0010243 GO:0010468 GO:0010556 GO:0010557 GO:0010604 GO:0010628 GO:0010646 GO:0010647 GO:0019219 GO:0019222 GO:0023051 GO:0023052 GO:0023056 GO:0031323 GO:0031325 GO:0031326 GO:0031328 GO:0031347 GO:0031349 GO:0032870 GO:0035556 GO:0042221 GO:0042493 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043565 GO:0044424 GO:0044464 GO:0045893 GO:0045935 GO:0048518 GO:0048522 GO:0048583 GO:0048584 GO:0050789 GO:0050794 GO:0050896 GO:0051171 GO:0051173 GO:0051252 GO:0051254 GO:0051716 GO:0060255 GO:0065007 GO:0070887 GO:0071310 GO:0071369 GO:0071495 GO:0080090 GO:0080134 GO:0090332 GO:0097159 GO:0140110 GO:1901363 GO:1901419 GO:1901421 GO:1901698 GO:1901700 GO:1902680 GO:1903506 GO:1903508 GO:1905957 GO:1905959 GO:2000112 GO:2001141

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

AP2

Protein Analysis

125

Amino Acids

13.45

Weight (kDa)

4.94

Isoelectric Point (pI)

48.16

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000120)

Species	Orthologous Gene IDs
malus_domestica	MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica	Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis	pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc16I	TGCGCA	1 cut(s)	256
AccB1I	GGYRCC	1 cut(s)	78
AciI	CCGC	2 cut(s)	301, 323
AclWI	GGATC	1 cut(s)	41
AcoI	YGGCCR	1 cut(s)	219
AcuI	CTGAAG	1 cut(s)	201
AcyI	GRCGYC	1 cut(s)	79
AfiI	CCNNNNNNNGG	2 cut(s)	65, 113
AgsI	TTSAA	3 cut(s)	227, 311, 361
AluBI	AGCT	2 cut(s)	149, 161
AluI	AGCT	2 cut(s)	149, 161
Alw26I	GTCTC	1 cut(s)	41
AlwI	GGATC	1 cut(s)	41
AlwNI	CAGNNNCTG	1 cut(s)	263
AoxI	GGCC	2 cut(s)	219, 277
ApeKI	GCWGC	2 cut(s)	42, 193
AspLEI	GCGC	2 cut(s)	81, 257
AspS9I	GGNCC	3 cut(s)	104, 207, 277
AsuHPI	GGTGA	1 cut(s)	128
AvaII	GGWCC	2 cut(s)	104, 207
BaeGI	GKGCMC	1 cut(s)	60
BanI	GGYRCC	1 cut(s)	78
BbsI	GAAGAC	1 cut(s)	126
BbvI	GCAGC	2 cut(s)	54, 180
BccI	CCATC	1 cut(s)	313
BceAI	ACGGC	1 cut(s)	206
BcoDI	GTCTC	1 cut(s)	41
BfaI	CTAG	1 cut(s)	162
BfoI	RGCGCY	1 cut(s)	82
BisI	GCNGC	2 cut(s)	43, 194
BlsI	GCNGC	2 cut(s)	44, 195
Bme18I	GGWCC	2 cut(s)	104, 207
BmgT120I	GGNCC	3 cut(s)	104, 207, 277
BmiI	GGNNCC	3 cut(s)	80, 167, 342
BpiI	GAAGAC	1 cut(s)	126
BsaHI	GRCGYC	1 cut(s)	79
BsaWI	WCCGGW	1 cut(s)	49
Bsc4I	CCNNNNNNNGG	2 cut(s)	65, 113
BseLI	CCNNNNNNNGG	2 cut(s)	65, 113
BseMII	CTCAG	1 cut(s)	52
BseRI	GAGGAG	1 cut(s)	161
BseSI	GKGCMC	1 cut(s)	60
BseXI	GCAGC	2 cut(s)	54, 180
BshFI	GGCC	2 cut(s)	221, 279
BshNI	GGYRCC	1 cut(s)	78
BsiSI	CCGG	1 cut(s)	50
BslFI	GGGAC	1 cut(s)	217
BslI	CCNNNNNNNGG	2 cut(s)	65, 113
BsmAI	GTCTC	1 cut(s)	41
BsmFI	GGGAC	1 cut(s)	217
BsnI	GGCC	2 cut(s)	221, 279
Bsp1286I	GDGCHC	1 cut(s)	60
Bsp143I	GATC	1 cut(s)	46
BspACI	CCGC	2 cut(s)	301, 323
BspANI	GGCC	2 cut(s)	221, 279
BspCNI	CTCAG	1 cut(s)	51
BspLI	GGNNCC	3 cut(s)	80, 167, 342
BspPI	GGATC	1 cut(s)	41
BspT107I	GGYRCC	1 cut(s)	78
BssMI	GATC	1 cut(s)	46
BssNI	GRCGYC	1 cut(s)	79
Bst4CI	ACNGT	2 cut(s)	104, 207
Bst6I	CTCTTC	1 cut(s)	351
BstACI	GRCGYC	1 cut(s)	79
BstC8I	GCNNGC	2 cut(s)	259, 295
BstDEI	CTNAG	3 cut(s)	25, 38, 242
BstENI	CCTNNNNNAGG	1 cut(s)	111
BstH2I	RGCGCY	1 cut(s)	82
BstHHI	GCGC	2 cut(s)	81, 257
BstKTI	GATC	1 cut(s)	49
BstMAI	GTCTC	1 cut(s)	41
BstMBI	GATC	1 cut(s)	46
BstMWI	GCNNNNNNNGC	1 cut(s)	146
BstSLI	GKGCMC	1 cut(s)	60
BstV1I	GCAGC	2 cut(s)	54, 180
BstV2I	GAAGAC	1 cut(s)	126
BsuRI	GGCC	2 cut(s)	221, 279
BtsIMutI	CAGTG	1 cut(s)	257
Cac8I	GCNNGC	2 cut(s)	259, 295
CaiI	CAGNNNCTG	1 cut(s)	263
CfoI	GCGC	2 cut(s)	81, 257
Cfr13I	GGNCC	3 cut(s)	104, 207, 277
CpoI	CGGWCCG	1 cut(s)	207
CseI	GACGC	1 cut(s)	146
CspI	CGGWCCG	1 cut(s)	207
CviAII	CATG	1 cut(s)	274
CviJI	RGCY	6 cut(s)	149, 161, 193, 221, 261, 279
CviKI_1	RGCY	6 cut(s)	149, 161, 193, 221, 261, 279
DdeI	CTNAG	3 cut(s)	25, 38, 242
DinI	GGCGCC	1 cut(s)	80
DpnI	GATC	1 cut(s)	48
DpnII	GATC	1 cut(s)	46
EaeI	YGGCCR	1 cut(s)	219
Eam1104I	CTCTTC	1 cut(s)	351
EarI	CTCTTC	1 cut(s)	351
EciI	GGCGGA	1 cut(s)	338
Eco47I	GGWCC	2 cut(s)	104, 207
Eco57I	CTGAAG	1 cut(s)	201
EcoNI	CCTNNNNNAGG	1 cut(s)	111
EgeI	GGCGCC	1 cut(s)	80
EheI	GGCGCC	1 cut(s)	80
FaeI	CATG	1 cut(s)	277
FaiI	YATR	2 cut(s)	76, 275
FaqI	GGGAC	1 cut(s)	217
FatI	CATG	1 cut(s)	273
FauI	CCCGC	1 cut(s)	308
Fnu4HI	GCNGC	2 cut(s)	43, 194
Fsp4HI	GCNGC	2 cut(s)	43, 194
FspBI	CTAG	1 cut(s)	162
FspI	TGCGCA	1 cut(s)	256
GlaI	GCGC	2 cut(s)	80, 256
GluI	GCNGC	2 cut(s)	43, 194
HaeII	RGCGCY	1 cut(s)	82
HaeIII	GGCC	2 cut(s)	221, 279
HapII	CCGG	1 cut(s)	50
HgaI	GACGC	1 cut(s)	146
HhaI	GCGC	2 cut(s)	81, 257
Hin1I	GRCGYC	1 cut(s)	79
Hin1II	CATG	1 cut(s)	277
Hin6I	GCGC	2 cut(s)	79, 255
HinP1I	GCGC	2 cut(s)	79, 255
HinfI	GANTC	4 cut(s)	34, 122, 230, 311
HpaII	CCGG	1 cut(s)	50
HphI	GGTGA	1 cut(s)	128
Hpy188I	TCNGA	1 cut(s)	211
Hpy188III	TCNNGA	3 cut(s)	179, 201, 227
HpyAV	CCTTC	2 cut(s)	93, 127
HpyCH4III	ACNGT	2 cut(s)	104, 207
HpyCH4IV	ACGT	1 cut(s)	364
HpyCH4V	TGCA	1 cut(s)	368
HpyF10VI	GCNNNNNNNGC	1 cut(s)	146
HpyF3I	CTNAG	3 cut(s)	25, 38, 242
HpySE526I	ACGT	1 cut(s)	364
Hsp92I	GRCGYC	1 cut(s)	79
Hsp92II	CATG	1 cut(s)	277
HspAI	GCGC	2 cut(s)	79, 255
KasI	GGCGCC	1 cut(s)	78
Kzo9I	GATC	1 cut(s)	46
LmnI	GCTCC	1 cut(s)	302
LpnPI	CCDG	5 cut(s)	63, 99, 186, 192, 243
Lsp1109I	GCAGC	2 cut(s)	54, 180
MaeI	CTAG	1 cut(s)	162
MaeII	ACGT	1 cut(s)	364
MalI	GATC	1 cut(s)	48
MboI	GATC	1 cut(s)	46
MboII	GAAGA	4 cut(s)	87, 131, 194, 338
MhlI	GDGCHC	1 cut(s)	60
Mly113I	GGCGCC	1 cut(s)	79
MlyI	GAGTC	3 cut(s)	43, 116, 239
MmeI	TCCRAC	1 cut(s)	294
MnlI	CCTC	6 cut(s)	117, 179, 182, 245, 319, 354
MspI	CCGG	1 cut(s)	50
MwoI	GCNNNNNNNGC	1 cut(s)	146
NarI	GGCGCC	1 cut(s)	79
NdeII	GATC	1 cut(s)	46
NlaIII	CATG	1 cut(s)	277
NlaIV	GGNNCC	3 cut(s)	80, 167, 342
NsbI	TGCGCA	1 cut(s)	256
PfeI	GAWTC	1 cut(s)	311
PkrI	GCNGC	2 cut(s)	44, 195
PleI	GAGTC	3 cut(s)	42, 116, 238
PluTI	GGCGCC	1 cut(s)	82
PpsI	GAGTC	3 cut(s)	42, 116, 238
PspN4I	GGNNCC	3 cut(s)	80, 167, 342
PspPI	GGNCC	3 cut(s)	104, 207, 277
PstNI	CAGNNNCTG	1 cut(s)	263
Rsr2I	CGGWCCG	1 cut(s)	207
RsrII	CGGWCCG	1 cut(s)	207
SatI	GCNGC	2 cut(s)	43, 194
Sau3AI	GATC	1 cut(s)	46
Sau96I	GGNCC	3 cut(s)	104, 207, 277
SchI	GAGTC	3 cut(s)	43, 116, 239
SduI	GDGCHC	1 cut(s)	60
SetI	ASST	8 cut(s)	21, 70, 118, 151, 163, 171, 330, 367
SfoI	GGCGCC	1 cut(s)	80
SinI	GGWCC	2 cut(s)	104, 207
SsiI	CCGC	2 cut(s)	301, 323
SspDI	GGCGCC	1 cut(s)	78
SspMI	CTAG	1 cut(s)	162
TaaI	ACNGT	2 cut(s)	104, 207
TaiI	ACGT	1 cut(s)	367
TaqI	TCGA	1 cut(s)	14
TfiI	GAWTC	1 cut(s)	311
TscAI	CASTG	1 cut(s)	257
TseI	GCWGC	2 cut(s)	42, 193
TspDTI	ATGAA	1 cut(s)	146
TspRI	CASTG	1 cut(s)	257
VpaK11BI	GGWCC	2 cut(s)	104, 207
XagI	CCTNNNNNAGG	1 cut(s)	111
XspI	CTAG	1 cut(s)	162

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.