Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr08

Orthogroup ID

OG0000120

Physical Location & Seq

Genomic Coordinates Reverse (-)

10820038 .. 10824195

Gene Structure 4158 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD08G1118400.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 438 bp

ATGAGGACTTTGTGTGCAGGTTCTGTGTCGAATATGGCACAACGCCTATTTGCTCGAACCCGCCAAGTTGAATCATTGGCGGCTGAAGTGATGAGTCTCAAGCAGGAGATTAGAGGGCTCAAGCATGAGAATAAACAGTTGCACAGGTTCGCACATGACTATGCTACAAACATGAAGAGGAAGCTTGACCAGGTGAAGGAATCTGATGGTCAGATTTTACTTGATCATCAGAGGTTTTTGGGTTTGTTCCAAAGGCATTTATTGTCTTCGTCTTCTGGGGCTGTACCACGTAATGAAGCTCCAAATGATCAGCATCTGATGCCTCTTCCTTCTAGGGTTCTGTCCAATACTAAGGCTCCGAGTCATCACCCTCCGGTGCCTTCTCTTTCTAGGGCTCTACCGACTGCTGAGACTTCTCCTAAGCAACCTTTATCCTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004177 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005829 GO:0006508 GO:0006807 GO:0008150 GO:0008152 GO:0008233 GO:0008238 GO:0008239 GO:0016787 GO:0019538 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044238 GO:0044424 GO:0044444 GO:0044464 GO:0070011 GO:0071704 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

NUDIX Peptidase_M49

Protein Analysis

146

Amino Acids

16.25

Weight (kDa)

10.27

Isoelectric Point (pI)

55.4

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000120)

Species	Orthologous Gene IDs
malus_domestica	MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica	Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis	pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	8
AccB1I	GGYRCC	1 cut(s)	376
AciI	CCGC	2 cut(s)	61, 80
AcuI	CTGAAG	1 cut(s)	105
AfaI	GTAC	1 cut(s)	285
AfiI	CCNNNNNNNGG	1 cut(s)	196
AgsI	TTSAA	1 cut(s)	71
AjnI	CCWGG	1 cut(s)	189
AluBI	AGCT	2 cut(s)	184, 299
AluI	AGCT	2 cut(s)	184, 299
Alw26I	GTCTC	2 cut(s)	101, 404
AlwNI	CAGNNNCTG	2 cut(s)	23, 316
AsuHPI	GGTGA	2 cut(s)	205, 359
BanI	GGYRCC	1 cut(s)	376
BanII	GRGCYC	2 cut(s)	120, 397
BbsI	GAAGAC	2 cut(s)	258, 264
BccI	CCATC	1 cut(s)	200
BciT130I	CCWGG	1 cut(s)	191
BclI	TGATCA	2 cut(s)	223, 307
BcoDI	GTCTC	2 cut(s)	101, 404
BfaI	CTAG	3 cut(s)	333, 390, 436
BfuAI	ACCTGC	1 cut(s)	8
BisI	GCNGC	1 cut(s)	81
BlsI	GCNGC	1 cut(s)	82
Bme1390I	CCNGG	1 cut(s)	191
BmiI	GGNNCC	2 cut(s)	357, 378
BmrFI	CCNGG	1 cut(s)	191
BmsI	GCATC	2 cut(s)	309, 322
BpiI	GAAGAC	2 cut(s)	258, 264
Bpu10I	CCTNAGC	1 cut(s)	420
BpuEI	CTTGAG	2 cut(s)	83, 104
BsaAI	YACGTR	1 cut(s)	290
BsaBI	GATNNNNATC	1 cut(s)	312
BsaWI	WCCGGW	1 cut(s)	373
BsaXI	ACNNNNNCTCC	2 cut(s)	340, 370
Bsc4I	CCNNNNNNNGG	1 cut(s)	196
Bse8I	GATNNNNATC	1 cut(s)	312
BseBI	CCWGG	1 cut(s)	191
BseJI	GATNNNNATC	1 cut(s)	312
BseLI	CCNNNNNNNGG	1 cut(s)	196
BseMII	CTCAG	1 cut(s)	399
BsgI	GTGCAG	1 cut(s)	36
BshNI	GGYRCC	1 cut(s)	376
BsiSI	CCGG	1 cut(s)	374
BslI	CCNNNNNNNGG	1 cut(s)	196
BsmAI	GTCTC	2 cut(s)	101, 404
Bsp1286I	GDGCHC	2 cut(s)	120, 397
Bsp143I	GATC	2 cut(s)	223, 307
BspACI	CCGC	2 cut(s)	61, 80
BspCNI	CTCAG	1 cut(s)	400
BspLI	GGNNCC	2 cut(s)	357, 378
BspMI	ACCTGC	1 cut(s)	8
BspT107I	GGYRCC	1 cut(s)	376
BssMI	GATC	2 cut(s)	223, 307
Bst2UI	CCWGG	1 cut(s)	191
Bst4CI	ACNGT	1 cut(s)	138
Bst6I	CTCTTC	2 cut(s)	170, 330
BstAPI	GCANNNNNTGC	1 cut(s)	319
BstBAI	YACGTR	1 cut(s)	290
BstDEI	CTNAG	3 cut(s)	351, 408, 420
BstKTI	GATC	2 cut(s)	226, 310
BstMAI	GTCTC	2 cut(s)	101, 404
BstMBI	GATC	2 cut(s)	223, 307
BstMWI	GCNNNNNNNGC	1 cut(s)	319
BstNI	CCWGG	1 cut(s)	191
BstSCI	CCNGG	1 cut(s)	189
BstV2I	GAAGAC	2 cut(s)	258, 264
BveI	ACCTGC	1 cut(s)	8
CaiI	CAGNNNCTG	2 cut(s)	23, 316
CsiI	ACCWGGT	1 cut(s)	189
Csp6I	GTAC	1 cut(s)	284
CviAII	CATG	3 cut(s)	125, 155, 172
CviJI	RGCY	7 cut(s)	83, 118, 184, 281, 299, 356, 395
CviKI_1	RGCY	7 cut(s)	83, 118, 184, 281, 299, 356, 395
CviQI	GTAC	1 cut(s)	284
DdeI	CTNAG	3 cut(s)	351, 408, 420
DpnI	GATC	2 cut(s)	225, 309
DpnII	GATC	2 cut(s)	223, 307
Eam1104I	CTCTTC	2 cut(s)	170, 330
EarI	CTCTTC	2 cut(s)	170, 330
Eco24I	GRGCYC	2 cut(s)	120, 397
Eco57I	CTGAAG	1 cut(s)	105
EcoRII	CCWGG	1 cut(s)	189
EcoT38I	GRGCYC	2 cut(s)	120, 397
FaeI	CATG	3 cut(s)	128, 158, 175
FaiI	YATR	5 cut(s)	35, 126, 156, 162, 173
FatI	CATG	3 cut(s)	124, 154, 171
FauI	CCCGC	1 cut(s)	68
FbaI	TGATCA	2 cut(s)	223, 307
Fnu4HI	GCNGC	1 cut(s)	81
FriOI	GRGCYC	2 cut(s)	120, 397
Fsp4HI	GCNGC	1 cut(s)	81
FspBI	CTAG	3 cut(s)	333, 390, 436
GluI	GCNGC	1 cut(s)	81
HapII	CCGG	1 cut(s)	374
Hin1II	CATG	3 cut(s)	128, 158, 175
HindIII	AAGCTT	1 cut(s)	182
HinfI	GANTC	4 cut(s)	71, 94, 200, 361
HpaII	CCGG	1 cut(s)	374
HphI	GGTGA	2 cut(s)	205, 359
Hpy188I	TCNGA	5 cut(s)	205, 213, 231, 318, 360
HpyAV	CCTTC	3 cut(s)	190, 339, 390
HpyCH4III	ACNGT	1 cut(s)	138
HpyCH4IV	ACGT	1 cut(s)	289
HpyCH4V	TGCA	2 cut(s)	17, 142
HpyF10VI	GCNNNNNNNGC	1 cut(s)	319
HpyF3I	CTNAG	3 cut(s)	351, 408, 420
HpySE526I	ACGT	1 cut(s)	289
Hsp92II	CATG	3 cut(s)	128, 158, 175
Ksp22I	TGATCA	2 cut(s)	223, 307
Kzo9I	GATC	2 cut(s)	223, 307
LmnI	GCTCC	2 cut(s)	304, 361
LpnPI	CCDG	7 cut(s)	3, 89, 130, 176, 203, 261, 387
LweI	GCATC	2 cut(s)	309, 322
MabI	ACCWGGT	1 cut(s)	189
MaeI	CTAG	3 cut(s)	333, 390, 436
MaeII	ACGT	1 cut(s)	289
MalI	GATC	2 cut(s)	225, 309
MboI	GATC	2 cut(s)	223, 307
MboII	GAAGA	4 cut(s)	187, 258, 264, 317
MhlI	GDGCHC	2 cut(s)	120, 397
MlyI	GAGTC	2 cut(s)	103, 370
MnlI	CCTC	5 cut(s)	107, 171, 225, 333, 381
MslI	CAYNNNNRTG	1 cut(s)	159
MspI	CCGG	1 cut(s)	374
MspR9I	CCNGG	1 cut(s)	191
MvaI	CCWGG	1 cut(s)	191
MwoI	GCNNNNNNNGC	1 cut(s)	319
NdeII	GATC	2 cut(s)	223, 307
NlaIII	CATG	3 cut(s)	128, 158, 175
NlaIV	GGNNCC	2 cut(s)	357, 378
PfeI	GAWTC	2 cut(s)	71, 200
PkrI	GCNGC	1 cut(s)	82
PleI	GAGTC	2 cut(s)	102, 369
PpsI	GAGTC	2 cut(s)	102, 369
Ppu21I	YACGTR	1 cut(s)	290
Psp6I	CCWGG	1 cut(s)	189
PspGI	CCWGG	1 cut(s)	189
PspN4I	GGNNCC	2 cut(s)	357, 378
PstNI	CAGNNNCTG	2 cut(s)	23, 316
RsaI	GTAC	1 cut(s)	285
RsaNI	GTAC	1 cut(s)	284
RseI	CAYNNNNRTG	1 cut(s)	159
SatI	GCNGC	1 cut(s)	81
Sau3AI	GATC	2 cut(s)	223, 307
SchI	GAGTC	2 cut(s)	103, 370
ScrFI	CCNGG	1 cut(s)	191
SduI	GDGCHC	2 cut(s)	120, 397
SetI	ASST	8 cut(s)	22, 149, 186, 195, 236, 292, 301, 430
SexAI	ACCWGGT	1 cut(s)	189
SfaNI	GCATC	2 cut(s)	309, 322
SmiMI	CAYNNNNRTG	1 cut(s)	159
SmlI	CTYRAG	2 cut(s)	98, 119
SmoI	CTYRAG	2 cut(s)	98, 119
SsiI	CCGC	2 cut(s)	61, 80
SspMI	CTAG	3 cut(s)	333, 390, 436
StyD4I	CCNGG	1 cut(s)	189
TaaI	ACNGT	1 cut(s)	138
TaiI	ACGT	1 cut(s)	292
TaqI	TCGA	2 cut(s)	29, 55
TauI	GCSGC	1 cut(s)	83
TfiI	GAWTC	2 cut(s)	71, 200
TspDTI	ATGAA	2 cut(s)	188, 309
XspI	CTAG	3 cut(s)	333, 390, 436

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.