pycom01g01060

Chloroplast-localized elongation factor EF-G involved in protein synthesis in plastids. Catalyzes the GTP-dependent ribosomal translocation step during translation elongation. During this step, the ribosome changes from the pre-translocational (PRE) to the post-translocational (POST) state as the newly formed A- site-bound peptidyl-tRNA and P-site-bound deacylated tRNA move to the P and E sites, respectively. Catalyzes the coordinated movement of the two tRNA molecules, the mRNA and conformational changes in the ribosome

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr1
Physical Location & Seq
Reverse (-)
1064449 .. 1065846
1398 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom01g01060.2

Sequence Viewer

Length: 1317 bp
ATGCAGAGTGTCCCTACATTTGGTGCTCCTTATAGGCAAGAATATCAAGCAAATCTATGTCCACAAAGAAATTGGAGTGATCATTCAAACTCTATGTGGTGGGAATCTCAAAAAGTTCAACAAGAGGGATATTGGCAGCCATATGAGGAGTTCTATTCAAGCCCTATGCAGCCACCACAACTTCATATGCAATATGCTCAATTAAATTCAAGTTCGTCAATAGATTATAATCAAATTCTTAATGAATTAAATTCTTTGGTGCAGGGGTCACAAAATCAAGCCAAGGAGGCTCAACAAGAAGCATATTGGCAACCATATGAGGAGTTCTATTCAACACCTATGCAGCCACCACAACCTCCCCCACAACAATTCCAATCAAGTTCAAGTATGTCCATGGATAATGATAAAATTTTTCAATTACTAACCTCTTTGACGCAGGACGAACAAAATCAAGACAAGAAGTTGGGTAAATTGGAGGAGCAAATTGGGCAGATTATGGAGTTCATGAAACAAATTCAAGAGCAAAGTGAACTCTCCAACTCAACTATTGAAAACTCGAAGGAAGATTTTGAAATCCATAATGCTATCACTTTGGGAAGTGCTATGGAGGTTGGAGCTGACCTAAAAATGTCCAAACATAGCCTAGAAGTGGATGAGGAGCTGCTAATTGAGGAGGAGGAAGAAGACATGCACACGGCAAGGGTAGAACAACCCTTGCCGCAGCCCCCTATGTCCTCTAAATCACCCACCACAAGTAAGGACGTCCCAATTTCATGTGATTCTGATGTTATTCCACCCAATGTCCCTTTTCCTAGCAGGTTTTTGATTCCCAACCAAGAAGAGAGTAAAAAGGACATCGTGGAAGCCTTCCCAAAGGTGCAAAATGCTATTCCAATTCTTGGTGCAACACAGCAAGTTTTAGATGGTGTTGAATTCTTCAAAGGACTTTGTACACCAAGACGAATGATTCAAGAGAAGGTAGTGGCAGAAGATGTAGAAGGCATCAAAGAGGACATATTTGAAACCACAAAACCCAAAGAAGTTGAATTTGATGACATTGGACAAGTCATAACCATCACATGCAATCTGGCCAAGTCCAATATCCCTGAAACTTTCAAAGGAGTGGTGTTTGTCATTGAGTTCTTGTTGGACAAAACAAGTAAGTCATCTTCTTCAAATTCCATTACATTTTATACTAACTTGCTGATTTTGATGAATCAGGCACCTACACTAGAATTCAAACCAATGCCGGTTCACTTCAAGTATCACCTTCCATTCAAGGATCAATTCCATGCCGTGGGACCTAGGGAAGTTTGA

Protein Analysis

439

Amino Acids

50.11

Weight (kDa)

4.59

Isoelectric Point (pI)

60.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 228
AatII GACGTC 1 cut(s) 765
Acc36I ACCTGC 1 cut(s) 807
AccB1I GGYRCC 1 cut(s) 1222
AccB7I CCANNNNNTGG 2 cut(s) 899, 1297
AciI CCGC 1 cut(s) 719
AclWI GGATC 1 cut(s) 1290
AcoI YGGCCR 1 cut(s) 1089
AcsI RAATTY 9 cut(s) 205, 234, 250, 408, 513, 932, 1046, 1177, 1235
AcyI GRCGYC 1 cut(s) 762
AfaI GTAC 1 cut(s) 952
AfiI CCNNNNNNNGG 4 cut(s) 20, 649, 899, 1297
AluBI AGCT 2 cut(s) 617, 661
AluI AGCT 2 cut(s) 617, 661
Alw21I GWGCWC 1 cut(s) 28
AlwI GGATC 1 cut(s) 1290
AoxI GGCC 1 cut(s) 1089
ApeKI GCWGC 5 cut(s) 136, 169, 343, 661, 721
ApoI RAATTY 9 cut(s) 205, 234, 250, 408, 513, 932, 1046, 1177, 1235
AspA2I CCTAGG 1 cut(s) 1304
AspS9I GGNCC 1 cut(s) 1301
AsuHPI GGTGA 2 cut(s) 735, 1259
AvaII GGWCC 1 cut(s) 1301
AvrII CCTAGG 1 cut(s) 1304
BalI TGGCCA 1 cut(s) 1091
BanI GGYRCC 1 cut(s) 1222
BarI GAAGNNNNNNTAC 2 cut(s) 1153, 1185
BbsI GAAGAC 1 cut(s) 690
Bbv12I GWGCWC 1 cut(s) 28
BbvI GCAGC 5 cut(s) 148, 181, 355, 648, 733
BccI CCATC 2 cut(s) 917, 1082
BceAI ACGGC 2 cut(s) 711, 1280
BclI TGATCA 1 cut(s) 79
BfaI CTAG 4 cut(s) 644, 813, 1232, 1305
BfuAI ACCTGC 1 cut(s) 807
BglI GCCNNNNNGGC 1 cut(s) 287
BisI GCNGC 6 cut(s) 137, 170, 344, 662, 719, 722
BlnI CCTAGG 1 cut(s) 1304
BlsI GCNGC 6 cut(s) 138, 171, 345, 663, 720, 723
Bme18I GGWCC 1 cut(s) 1301
BmgT120I GGNCC 1 cut(s) 1301
BmiI GGNNCC 2 cut(s) 1224, 1302
BmsI GCATC 1 cut(s) 1011
BpiI GAAGAC 1 cut(s) 690
BsaBI GATNNNNATC 1 cut(s) 228
BsaHI GRCGYC 1 cut(s) 762
BsaJI CCNNGG 4 cut(s) 282, 393, 1296, 1304
Bsc4I CCNNNNNNNGG 4 cut(s) 20, 649, 899, 1297
Bse118I RCCGGY 1 cut(s) 1249
Bse8I GATNNNNATC 1 cut(s) 228
BseDI CCNNGG 4 cut(s) 282, 393, 1296, 1304
BseGI GGATG 1 cut(s) 658
BseJI GATNNNNATC 1 cut(s) 228
BseLI CCNNNNNNNGG 4 cut(s) 20, 649, 899, 1297
BseRI GAGGAG 6 cut(s) 161, 335, 491, 671, 686, 689
BseXI GCAGC 5 cut(s) 148, 181, 355, 648, 733
BsgI GTGCAG 1 cut(s) 281
BshFI GGCC 1 cut(s) 1091
BshNI GGYRCC 1 cut(s) 1222
BsiHKAI GWGCWC 1 cut(s) 28
BsiSI CCGG 1 cut(s) 1250
BslFI GGGAC 2 cut(s) 749, 788
BslI CCNNNNNNNGG 4 cut(s) 20, 649, 899, 1297
BsmFI GGGAC 2 cut(s) 749, 788
BsnI GGCC 1 cut(s) 1091
Bsp1286I GDGCHC 1 cut(s) 28
Bsp1407I TGTACA 1 cut(s) 950
Bsp143I GATC 2 cut(s) 79, 1282
Bsp19I CCATGG 1 cut(s) 393
BspACI CCGC 1 cut(s) 719
BspANI GGCC 1 cut(s) 1091
BspHI TCATGA 1 cut(s) 504
BspLI GGNNCC 2 cut(s) 1224, 1302
BspMI ACCTGC 1 cut(s) 807
BspPI GGATC 1 cut(s) 1290
BspT107I GGYRCC 1 cut(s) 1222
BsrFI RCCGGY 1 cut(s) 1249
BsrGI TGTACA 1 cut(s) 950
BssAI RCCGGY 1 cut(s) 1249
BssECI CCNNGG 4 cut(s) 282, 393, 1296, 1304
BssMI GATC 2 cut(s) 79, 1282
BssNI GRCGYC 1 cut(s) 762
BssT1I CCWWGG 3 cut(s) 282, 393, 1304
Bst6I CTCTTC 1 cut(s) 834
BstACI GRCGYC 1 cut(s) 762
BstAUI TGTACA 1 cut(s) 950
BstDSI CCRYGG 2 cut(s) 393, 1296
BstF5I GGATG 1 cut(s) 658
BstKTI GATC 2 cut(s) 82, 1285
BstMBI GATC 2 cut(s) 79, 1282
BstMWI GCNNNNNNNGC 2 cut(s) 287, 487
BstNSI RCATGY 2 cut(s) 691, 1083
BstV1I GCAGC 5 cut(s) 148, 181, 355, 648, 733
BstV2I GAAGAC 1 cut(s) 690
BsuRI GGCC 1 cut(s) 1091
BtgI CCRYGG 2 cut(s) 393, 1296
BtsCI GGATG 1 cut(s) 658
BveI ACCTGC 1 cut(s) 807
CciI TCATGA 1 cut(s) 504
Cfr10I RCCGGY 1 cut(s) 1249
Cfr13I GGNCC 1 cut(s) 1301
CseI GACGC 1 cut(s) 442
Csp6I GTAC 1 cut(s) 951
CviAII CATG 6 cut(s) 394, 505, 688, 774, 1080, 1292
CviQI GTAC 1 cut(s) 951
DpnI GATC 2 cut(s) 81, 1284
DpnII GATC 2 cut(s) 79, 1282
EaeI YGGCCR 1 cut(s) 1089
Eam1104I CTCTTC 1 cut(s) 834
EarI CTCTTC 1 cut(s) 834
Eco130I CCWWGG 3 cut(s) 282, 393, 1304
Eco47I GGWCC 1 cut(s) 1301
EcoO109I RGGNCCY 1 cut(s) 1301
EcoRI GAATTC 2 cut(s) 932, 1235
EcoT14I CCWWGG 3 cut(s) 282, 393, 1304
ErhI CCWWGG 3 cut(s) 282, 393, 1304
FaeI CATG 6 cut(s) 397, 508, 691, 777, 1083, 1295
FaqI GGGAC 2 cut(s) 749, 788
FatI CATG 6 cut(s) 393, 504, 687, 773, 1079, 1291
FauNDI CATATG 3 cut(s) 142, 186, 316
FbaI TGATCA 1 cut(s) 79
Fnu4HI GCNGC 6 cut(s) 137, 170, 344, 662, 719, 722
FokI GGATG 1 cut(s) 665
Fsp4HI GCNGC 6 cut(s) 137, 170, 344, 662, 719, 722
FspBI CTAG 4 cut(s) 644, 813, 1232, 1305
GluI GCNGC 6 cut(s) 137, 170, 344, 662, 719, 722
HaeIII GGCC 1 cut(s) 1091
HapII CCGG 1 cut(s) 1250
HgaI GACGC 1 cut(s) 442
Hin1I GRCGYC 1 cut(s) 762
Hin1II CATG 6 cut(s) 397, 508, 691, 777, 1083, 1295
HinfI GANTC 5 cut(s) 104, 779, 826, 967, 1216
HpaII CCGG 1 cut(s) 1250
HphI GGTGA 2 cut(s) 735, 1259
Hpy166II GTNNAC 4 cut(s) 62, 530, 953, 1255
Hpy188I TCNGA 1 cut(s) 784
Hpy188III TCNNGA 4 cut(s) 452, 505, 518, 971
Hpy8I GTNNAC 4 cut(s) 62, 530, 953, 1255
HpyAV CCTTC 5 cut(s) 553, 877, 970, 992, 1280
HpyCH4IV ACGT 1 cut(s) 762
HpyCH4V TGCA 9 cut(s) 4, 169, 190, 262, 343, 691, 880, 905, 1083
HpyF10VI GCNNNNNNNGC 2 cut(s) 287, 487
HpySE526I ACGT 1 cut(s) 762
Hsp92I GRCGYC 1 cut(s) 762
Hsp92II CATG 6 cut(s) 397, 508, 691, 777, 1083, 1295
Ksp22I TGATCA 1 cut(s) 79
Kzo9I GATC 2 cut(s) 79, 1282
LmnI GCTCC 4 cut(s) 31, 478, 614, 658
LpnPI CCDG 7 cut(s) 248, 422, 802, 1073, 1119, 1205, 1263
Lsp1109I GCAGC 5 cut(s) 148, 181, 355, 648, 733
LweI GCATC 1 cut(s) 1011
MaeI CTAG 4 cut(s) 644, 813, 1232, 1305
MaeII ACGT 1 cut(s) 762
MaeIII GTNAC 1 cut(s) 267
MalI GATC 2 cut(s) 81, 1284
MboI GATC 2 cut(s) 79, 1282
MboII GAAGA 8 cut(s) 575, 692, 695, 851, 928, 1001, 1161, 1164
MhlI GDGCHC 1 cut(s) 28
MlsI TGGCCA 1 cut(s) 1091
MluNI TGGCCA 1 cut(s) 1091
MmeI TCCRAC 3 cut(s) 561, 592, 1128
Mox20I TGGCCA 1 cut(s) 1091
MscI TGGCCA 1 cut(s) 1091
MseI TTAA 3 cut(s) 203, 240, 248
Msp20I TGGCCA 1 cut(s) 1091
MspI CCGG 1 cut(s) 1250
MwoI GCNNNNNNNGC 2 cut(s) 287, 487
NcoI CCATGG 1 cut(s) 393
NdeI CATATG 3 cut(s) 142, 186, 316
NdeII GATC 2 cut(s) 79, 1282
NlaIII CATG 6 cut(s) 397, 508, 691, 777, 1083, 1295
NlaIV GGNNCC 2 cut(s) 1224, 1302
NmuCI GTSAC 1 cut(s) 267
NspI RCATGY 2 cut(s) 691, 1083
PagI TCATGA 1 cut(s) 504
PfeI GAWTC 5 cut(s) 104, 779, 826, 967, 1216
PflMI CCANNNNNTGG 2 cut(s) 899, 1297
PkrI GCNGC 6 cut(s) 138, 171, 345, 663, 720, 723
PpuMI RGGWCCY 1 cut(s) 1301
PsiI TTATAA 1 cut(s) 228
Psp5II RGGWCCY 1 cut(s) 1301
PspN4I GGNNCC 2 cut(s) 1224, 1302
PspPI GGNCC 1 cut(s) 1301
PspPPI RGGWCCY 1 cut(s) 1301
RsaI GTAC 1 cut(s) 952
RsaNI GTAC 1 cut(s) 951
SaqAI TTAA 3 cut(s) 203, 240, 248
SatI GCNGC 6 cut(s) 137, 170, 344, 662, 719, 722
Sau3AI GATC 2 cut(s) 79, 1282
Sau96I GGNCC 1 cut(s) 1301
SduI GDGCHC 1 cut(s) 28
SfaNI GCATC 1 cut(s) 1011
SinI GGWCC 1 cut(s) 1301
SsiI CCGC 1 cut(s) 719
SspMI CTAG 4 cut(s) 644, 813, 1232, 1305
StyI CCWWGG 3 cut(s) 282, 393, 1304
TaiI ACGT 1 cut(s) 765
TaqI TCGA 1 cut(s) 557
TatI WGTACW 1 cut(s) 950
TauI GCSGC 1 cut(s) 721
TfiI GAWTC 5 cut(s) 104, 779, 826, 967, 1216
Tru1I TTAA 3 cut(s) 203, 240, 248
Tru9I TTAA 3 cut(s) 203, 240, 248
TseFI GTSAC 1 cut(s) 267
TseI GCWGC 5 cut(s) 136, 169, 343, 661, 721
Tsp45I GTSAC 1 cut(s) 267
TspDTI ATGAA 6 cut(s) 173, 258, 493, 521, 762, 1229
Van91I CCANNNNNTGG 2 cut(s) 899, 1297
VpaK11BI GGWCC 1 cut(s) 1301
XapI RAATTY 9 cut(s) 205, 234, 250, 408, 513, 932, 1046, 1177, 1235
XceI RCATGY 2 cut(s) 691, 1083
XcmI CCANNNNNNNNNTGG 1 cut(s) 69
XmaJI CCTAGG 1 cut(s) 1304
XspI CTAG 4 cut(s) 644, 813, 1232, 1305
ZraI GACGTC 1 cut(s) 763
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.