Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

tig00002749

Orthogroup ID

OG0000120

Physical Location & Seq

Genomic Coordinates Forward (+)

40476 .. 58590

Gene Structure 18115 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom2749g00080.3

Sequence Viewer

CDS Protein Promoter (2k)

Length: 753 bp

ATGAATCATGAATCATTGTGGATGAAAGGTGGAAGTGCATGTGTTGATAGGAGGCTAGGGGCAAACTCATCGAACCTTAGCTTAGATTTGAGTCTCAGCAGCGATCCGGTTGCGCCCCGTCAAGGTAATGTATGGCGCCCTTCTTTTTTATCTTCTAACGGTCCTCTTTCAGGTGAAGACTCTGTGATGCAGGATGCCACAACAGCTACAATAGTAGCTAAAAACCTCCTCACTCCAAAAGATAGTAGGCTGCTGTCAGGACGGTCCGATGAGTTGGCCGTTCAAGAGTCCCTCGCACTTAGTGTTCAGTGTGCGAGCTCTGTGTCCAACATGGGCCTACGCCTGCTTGCCCGCTCTCGTCAGGTGGAATCGTTGATGGCAGAGGTGGAAAGACTTAAGCAAGAGATCCAGCAGCTTAAGTACGAGAATAGAAGTTTGCATGTGCTTGCAAATAACTATTCGTCGGGGATGAAAAGGAAGCTTGATGAGCTGCAAGAATCTGAGGGTCGAATTCACAGTGACCGTCAAAGTCACGGCGACCGTCAAAGGTTTTCTGCTTATCTCCAGAGGCATCTTTTTCCTGGCTCATCCAGCGCTTGGCCAAGTATTGAGGCCTGGAATGCTCTAGCTCCGATGCCTCCCGCTCCGATGCCTTCTGCTCCTATGCCTTCCGCTCCGATGCCTCCCGCTCCGATGCCTTCCGCTTCAAGAGTAAAGCCACGTAGTGGGGCCTCAAGCAAACAACCTTTGTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004177 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005829 GO:0006508 GO:0006807 GO:0008150 GO:0008152 GO:0008233 GO:0008238 GO:0008239 GO:0016787 GO:0019538 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044238 GO:0044424 GO:0044444 GO:0044464 GO:0070011 GO:0071704 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

NUDIX Peptidase_M49

Protein Analysis

251

Amino Acids

27.21

Weight (kDa)

9.42

Isoelectric Point (pI)

71.96

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000120)

Species	Orthologous Gene IDs
malus_domestica	MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica	Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis	pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	135
AccB7I	CCANNNNNTGG	2 cut(s)	597, 725
AccBSI	CCGCTC	4 cut(s)	354, 644, 674, 689
AciI	CCGC	5 cut(s)	352, 642, 672, 687, 702
AclWI	GGATC	2 cut(s)	98, 400
AcoI	YGGCCR	2 cut(s)	276, 599
AcsI	RAATTY	1 cut(s)	510
AcyI	GRCGYC	1 cut(s)	136
AdeI	CACNNNGTG	2 cut(s)	302, 725
AfaI	GTAC	1 cut(s)	422
AfeI	AGCGCT	1 cut(s)	595
AfiI	CCNNNNNNNGG	4 cut(s)	122, 170, 597, 725
AflII	CTTAAG	2 cut(s)	395, 416
AgsI	TTSAA	2 cut(s)	284, 708
AjnI	CCWGG	2 cut(s)	580, 614
AluBI	AGCT	8 cut(s)	81, 206, 218, 318, 415, 481, 490, 629
AluI	AGCT	8 cut(s)	81, 206, 218, 318, 415, 481, 490, 629
Alw21I	GWGCWC	1 cut(s)	320
Alw26I	GTCTC	1 cut(s)	98
AlwI	GGATC	2 cut(s)	98, 400
Aor51HI	AGCGCT	1 cut(s)	595
AoxI	GGCC	5 cut(s)	276, 334, 599, 612, 729
ApeKI	GCWGC	4 cut(s)	99, 250, 412, 490
ApoI	RAATTY	1 cut(s)	510
AspLEI	GCGC	3 cut(s)	115, 138, 596
AspS9I	GGNCC	4 cut(s)	161, 264, 334, 729
AsuHPI	GGTGA	1 cut(s)	185
AvaII	GGWCC	2 cut(s)	161, 264
BalI	TGGCCA	1 cut(s)	601
BanI	GGYRCC	1 cut(s)	135
BanII	GRGCYC	1 cut(s)	320
BbsI	GAAGAC	1 cut(s)	183
Bbv12I	GWGCWC	1 cut(s)	320
BbvI	GCAGC	4 cut(s)	111, 237, 424, 477
BccI	CCATC	1 cut(s)	370
BceAI	ACGGC	2 cut(s)	263, 550
BcgI	CGANNNNNNTGC	4 cut(s)	51, 85, 92, 126
BciT130I	CCWGG	2 cut(s)	582, 616
BcoDI	GTCTC	1 cut(s)	98
BfaI	CTAG	2 cut(s)	56, 626
BfoI	RGCGCY	2 cut(s)	139, 597
BfrI	CTTAAG	2 cut(s)	395, 416
BisI	GCNGC	4 cut(s)	100, 251, 413, 491
BlsI	GCNGC	4 cut(s)	101, 252, 414, 492
Bme1390I	CCNGG	2 cut(s)	582, 616
Bme18I	GGWCC	2 cut(s)	161, 264
BmgT120I	GGNCC	4 cut(s)	161, 264, 334, 729
BmiI	GGNNCC	2 cut(s)	137, 730
BmrFI	CCNGG	2 cut(s)	582, 616
BmsI	GCATC	7 cut(s)	177, 184, 580, 624, 639, 669, 684
BpiI	GAAGAC	1 cut(s)	183
BpmI	CTGGAG	1 cut(s)	548
Bpu10I	CCTNAGC	1 cut(s)	77
BpuEI	CTTGAG	1 cut(s)	718
BsaAI	YACGTR	1 cut(s)	722
BsaHI	GRCGYC	1 cut(s)	136
BsaWI	WCCGGW	1 cut(s)	106
Bsc4I	CCNNNNNNNGG	4 cut(s)	122, 170, 597, 725
BseBI	CCWGG	2 cut(s)	582, 616
BseGI	GGATG	4 cut(s)	27, 199, 474, 587
BseLI	CCNNNNNNNGG	4 cut(s)	122, 170, 597, 725
BseMII	CTCAG	2 cut(s)	109, 492
BseRI	GAGGAG	1 cut(s)	218
BseXI	GCAGC	4 cut(s)	111, 237, 424, 477
Bsh1285I	CGRYCG	1 cut(s)	541
BshFI	GGCC	5 cut(s)	278, 336, 601, 614, 731
BshNI	GGYRCC	1 cut(s)	135
BsiEI	CGRYCG	1 cut(s)	541
BsiHKAI	GWGCWC	1 cut(s)	320
BsiSI	CCGG	1 cut(s)	107
BslFI	GGGAC	1 cut(s)	274
BslI	CCNNNNNNNGG	4 cut(s)	122, 170, 597, 725
BsmAI	GTCTC	1 cut(s)	98
BsmFI	GGGAC	1 cut(s)	274
BsmI	GAATGC	1 cut(s)	625
BsnI	GGCC	5 cut(s)	278, 336, 601, 614, 731
Bsp1286I	GDGCHC	1 cut(s)	320
Bsp143I	GATC	2 cut(s)	103, 405
BspACI	CCGC	5 cut(s)	352, 642, 672, 687, 702
BspANI	GGCC	5 cut(s)	278, 336, 601, 614, 731
BspCNI	CTCAG	2 cut(s)	108, 493
BspHI	TCATGA	1 cut(s)	7
BspLI	GGNNCC	2 cut(s)	137, 730
BspPI	GGATC	2 cut(s)	98, 400
BspT107I	GGYRCC	1 cut(s)	135
BspTI	CTTAAG	2 cut(s)	395, 416
BsrBI	CCGCTC	4 cut(s)	354, 644, 674, 689
BssMI	GATC	2 cut(s)	103, 405
BssNI	GRCGYC	1 cut(s)	136
Bst2UI	CCWGG	2 cut(s)	582, 616
Bst4CI	ACNGT	5 cut(s)	161, 264, 518, 524, 542
BstACI	GRCGYC	1 cut(s)	136
BstAFI	CTTAAG	2 cut(s)	395, 416
BstBAI	YACGTR	1 cut(s)	722
BstC8I	GCNNGC	5 cut(s)	316, 344, 348, 352, 447
BstDEI	CTNAG	5 cut(s)	77, 82, 95, 299, 501
BstENI	CCTNNNNNAGG	1 cut(s)	168
BstF5I	GGATG	4 cut(s)	27, 199, 474, 587
BstH2I	RGCGCY	2 cut(s)	139, 597
BstHHI	GCGC	3 cut(s)	115, 138, 596
BstKTI	GATC	2 cut(s)	106, 408
BstMAI	GTCTC	1 cut(s)	98
BstMBI	GATC	2 cut(s)	103, 405
BstMCI	CGRYCG	1 cut(s)	541
BstMWI	GCNNNNNNNGC	4 cut(s)	203, 487, 591, 620
BstNI	CCWGG	2 cut(s)	582, 616
BstNSI	RCATGY	2 cut(s)	42, 443
BstSCI	CCNGG	2 cut(s)	580, 614
BstV1I	GCAGC	4 cut(s)	111, 237, 424, 477
BstV2I	GAAGAC	1 cut(s)	183
BstX2I	RGATCY	1 cut(s)	405
BstYI	RGATCY	1 cut(s)	405
BsuRI	GGCC	5 cut(s)	278, 336, 601, 614, 731
BtsCI	GGATG	4 cut(s)	27, 199, 474, 587
BtsIMutI	CAGTG	2 cut(s)	314, 523
Cac8I	GCNNGC	5 cut(s)	316, 344, 348, 352, 447
CciI	TCATGA	1 cut(s)	7
CfoI	GCGC	3 cut(s)	115, 138, 596
Cfr13I	GGNCC	4 cut(s)	161, 264, 334, 729
CpoI	CGGWCCG	1 cut(s)	264
Csp6I	GTAC	1 cut(s)	421
CspI	CGGWCCG	1 cut(s)	264
CviAII	CATG	4 cut(s)	8, 39, 331, 440
CviQI	GTAC	1 cut(s)	421
DdeI	CTNAG	5 cut(s)	77, 82, 95, 299, 501
DinI	GGCGCC	1 cut(s)	137
DpnI	GATC	2 cut(s)	105, 407
DpnII	GATC	2 cut(s)	103, 405
DraIII	CACNNNGTG	2 cut(s)	302, 725
EaeI	YGGCCR	2 cut(s)	276, 599
Ecl136II	GAGCTC	1 cut(s)	318
Eco147I	AGGCCT	1 cut(s)	614
Eco24I	GRGCYC	1 cut(s)	320
Eco47I	GGWCC	2 cut(s)	161, 264
Eco47III	AGCGCT	1 cut(s)	595
Eco53kI	GAGCTC	1 cut(s)	318
EcoICRI	GAGCTC	1 cut(s)	318
EcoNI	CCTNNNNNAGG	1 cut(s)	168
EcoO109I	RGGNCCY	1 cut(s)	729
EcoRI	GAATTC	1 cut(s)	510
EcoRII	CCWGG	2 cut(s)	580, 614
EcoT38I	GRGCYC	1 cut(s)	320
EgeI	GGCGCC	1 cut(s)	137
EheI	GGCGCC	1 cut(s)	137
FaeI	CATG	4 cut(s)	11, 42, 334, 443
FaiI	YATR	6 cut(s)	9, 40, 133, 332, 441, 665
FaqI	GGGAC	1 cut(s)	274
FatI	CATG	4 cut(s)	7, 38, 330, 439
FauI	CCCGC	3 cut(s)	359, 649, 694
Fnu4HI	GCNGC	4 cut(s)	100, 251, 413, 491
FokI	GGATG	4 cut(s)	34, 206, 481, 574
FriOI	GRGCYC	1 cut(s)	320
Fsp4HI	GCNGC	4 cut(s)	100, 251, 413, 491
FspBI	CTAG	2 cut(s)	56, 626
GlaI	GCGC	3 cut(s)	114, 137, 595
GluI	GCNGC	4 cut(s)	100, 251, 413, 491
GsuI	CTGGAG	1 cut(s)	548
HaeII	RGCGCY	2 cut(s)	139, 597
HaeIII	GGCC	5 cut(s)	278, 336, 601, 614, 731
HapII	CCGG	1 cut(s)	107
HhaI	GCGC	3 cut(s)	115, 138, 596
Hin1I	GRCGYC	1 cut(s)	136
Hin1II	CATG	4 cut(s)	11, 42, 334, 443
Hin6I	GCGC	3 cut(s)	113, 136, 594
HinP1I	GCGC	3 cut(s)	113, 136, 594
HindIII	AAGCTT	1 cut(s)	479
HinfI	GANTC	7 cut(s)	4, 11, 91, 179, 287, 368, 497
HpaII	CCGG	1 cut(s)	107
HphI	GGTGA	1 cut(s)	185
Hpy188I	TCNGA	6 cut(s)	268, 502, 633, 648, 678, 693
Hpy188III	TCNNGA	5 cut(s)	8, 258, 284, 565, 708
Hpy99I	CGWCG	1 cut(s)	466
HpyAV	CCTTC	4 cut(s)	150, 663, 678, 708
HpyCH4III	ACNGT	5 cut(s)	161, 264, 518, 524, 542
HpyCH4IV	ACGT	1 cut(s)	721
HpyCH4V	TGCA	5 cut(s)	38, 190, 439, 449, 493
HpyF10VI	GCNNNNNNNGC	4 cut(s)	203, 487, 591, 620
HpyF3I	CTNAG	5 cut(s)	77, 82, 95, 299, 501
HpySE526I	ACGT	1 cut(s)	721
Hsp92I	GRCGYC	1 cut(s)	136
Hsp92II	CATG	4 cut(s)	11, 42, 334, 443
HspAI	GCGC	3 cut(s)	113, 136, 594
KasI	GGCGCC	1 cut(s)	135
Kzo9I	GATC	2 cut(s)	103, 405
LmnI	GCTCC	5 cut(s)	634, 649, 664, 679, 694
Lsp1109I	GCAGC	4 cut(s)	111, 237, 424, 477
LweI	GCATC	7 cut(s)	177, 184, 580, 624, 639, 669, 684
MaeI	CTAG	2 cut(s)	56, 626
MaeII	ACGT	1 cut(s)	721
MaeIII	GTNAC	2 cut(s)	518, 530
MalI	GATC	2 cut(s)	105, 407
MbiI	CCGCTC	4 cut(s)	354, 644, 674, 689
MboI	GATC	2 cut(s)	103, 405
MboII	GAAGA	2 cut(s)	144, 188
MflI	RGATCY	1 cut(s)	405
MhlI	GDGCHC	1 cut(s)	320
MlsI	TGGCCA	1 cut(s)	601
MluCI	AATT	1 cut(s)	510
MluNI	TGGCCA	1 cut(s)	601
Mly113I	GGCGCC	1 cut(s)	136
MlyI	GAGTC	3 cut(s)	100, 173, 296
MmeI	TCCRAC	1 cut(s)	351
Mox20I	TGGCCA	1 cut(s)	601
MscI	TGGCCA	1 cut(s)	601
MseI	TTAA	2 cut(s)	396, 417
Msp20I	TGGCCA	1 cut(s)	601
MspCI	CTTAAG	2 cut(s)	395, 416
MspI	CCGG	1 cut(s)	107
MspR9I	CCNGG	2 cut(s)	582, 616
Mva1269I	GAATGC	1 cut(s)	625
MvaI	CCWGG	2 cut(s)	582, 616
MwoI	GCNNNNNNNGC	4 cut(s)	203, 487, 591, 620
NarI	GGCGCC	1 cut(s)	136
NdeII	GATC	2 cut(s)	103, 405
NlaIII	CATG	4 cut(s)	11, 42, 334, 443
NlaIV	GGNNCC	2 cut(s)	137, 730
NmuCI	GTSAC	2 cut(s)	518, 530
NspI	RCATGY	2 cut(s)	42, 443
PagI	TCATGA	1 cut(s)	7
PceI	AGGCCT	1 cut(s)	614
PctI	GAATGC	1 cut(s)	625
PfeI	GAWTC	4 cut(s)	4, 11, 368, 497
PflMI	CCANNNNNTGG	2 cut(s)	597, 725
PkrI	GCNGC	4 cut(s)	101, 252, 414, 492
PleI	GAGTC	3 cut(s)	99, 173, 295
PluTI	GGCGCC	1 cut(s)	139
PpsI	GAGTC	3 cut(s)	99, 173, 295
Ppu21I	YACGTR	1 cut(s)	722
Psp124BI	GAGCTC	1 cut(s)	320
Psp6I	CCWGG	2 cut(s)	580, 614
PspGI	CCWGG	2 cut(s)	580, 614
PspN4I	GGNNCC	2 cut(s)	137, 730
PspPI	GGNCC	4 cut(s)	161, 264, 334, 729
PsuI	RGATCY	1 cut(s)	405
RsaI	GTAC	1 cut(s)	422
RsaNI	GTAC	1 cut(s)	421
Rsr2I	CGGWCCG	1 cut(s)	264
RsrII	CGGWCCG	1 cut(s)	264
SacI	GAGCTC	1 cut(s)	320
SaqAI	TTAA	2 cut(s)	396, 417
SatI	GCNGC	4 cut(s)	100, 251, 413, 491
Sau3AI	GATC	2 cut(s)	103, 405
Sau96I	GGNCC	4 cut(s)	161, 264, 334, 729
SchI	GAGTC	3 cut(s)	100, 173, 296
ScrFI	CCNGG	2 cut(s)	582, 616
SduI	GDGCHC	1 cut(s)	320
SfaNI	GCATC	7 cut(s)	177, 184, 580, 624, 639, 669, 684
SfoI	GGCGCC	1 cut(s)	137
SinI	GGWCC	2 cut(s)	161, 264
SmlI	CTYRAG	3 cut(s)	395, 416, 733
SmoI	CTYRAG	3 cut(s)	395, 416, 733
Sse9I	AATT	1 cut(s)	510
SseBI	AGGCCT	1 cut(s)	614
SsiI	CCGC	5 cut(s)	352, 642, 672, 687, 702
SspDI	GGCGCC	1 cut(s)	135
SspMI	CTAG	2 cut(s)	56, 626
SstI	GAGCTC	1 cut(s)	320
StuI	AGGCCT	1 cut(s)	614
StyD4I	CCNGG	2 cut(s)	580, 614
TaaI	ACNGT	5 cut(s)	161, 264, 518, 524, 542
TaiI	ACGT	1 cut(s)	724
TaqI	TCGA	2 cut(s)	71, 508
TasI	AATT	1 cut(s)	510
TfiI	GAWTC	4 cut(s)	4, 11, 368, 497
Tru1I	TTAA	2 cut(s)	396, 417
Tru9I	TTAA	2 cut(s)	396, 417
TscAI	CASTG	2 cut(s)	314, 523
TseFI	GTSAC	2 cut(s)	518, 530
TseI	GCWGC	4 cut(s)	99, 250, 412, 490
Tsp45I	GTSAC	2 cut(s)	518, 530
TspDTI	ATGAA	4 cut(s)	17, 24, 38, 485
TspRI	CASTG	2 cut(s)	314, 523
Van91I	CCANNNNNTGG	2 cut(s)	597, 725
Vha464I	CTTAAG	2 cut(s)	395, 416
VpaK11BI	GGWCC	2 cut(s)	161, 264
XagI	CCTNNNNNAGG	1 cut(s)	168
XapI	RAATTY	1 cut(s)	510
XceI	RCATGY	2 cut(s)	42, 443
XspI	CTAG	2 cut(s)	56, 626

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.