Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

tig00012462

Orthogroup ID

OG0000120

Physical Location & Seq

Genomic Coordinates Reverse (-)

91179 .. 93923

Gene Structure 2745 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom12462g00070.3

Sequence Viewer

CDS Protein Promoter (2k)

Length: 579 bp

ATGCAGGACGCCACAACAGCTACAATAGTAGCTAGGAACCTCCTCACTCCAAAAGATAGTAGGCTGCTGTCAGGACGGTCCGATGAGTTGGCCGTTCAAGAGTCCCTCGCACTTAGTGTTCAGTGTGCGAGTTCTGTGTCCAACATGGGCCAACGCCTGCTTGCCCGCTCCCGTCAGGTGGAATCATTGATGGCAGAGGTGGAAAGTCTCAAGCAGGAGATCCAGCAGCTGAAGTATGAGAATAGAAGTTTGCACATGCTTGCAAACAACTATTCGACGGGCATGAAGAGGAAACTTGATGAGCTGCAAGAGTCTGAAGGTCGGATTCAAAGCGACCGTCAGAGGTTTTCGGCTTATCTCCAGAGGCACCTTTTTCCTGGGTCATCCAGCGTTTGGCCAAGTATTGAGGCCTGGAATGCTCTAGCTCCGATGCCTCCCGCTCCGATCCACGTAGTGGGGCCTCAAGCAAACAACCTCTGCATGCGACAATTCAAAACATTCCCCACAAGTCCTCAACATGAATGCATAGAAGAGATACAAGCAAGAATCATTAAGCTCTATGAAAATTATAAGTGTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004177 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005829 GO:0006508 GO:0006807 GO:0008150 GO:0008152 GO:0008233 GO:0008238 GO:0008239 GO:0016787 GO:0019538 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044238 GO:0044424 GO:0044444 GO:0044464 GO:0070011 GO:0071704 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

NUDIX Peptidase_M49

Protein Analysis

193

Amino Acids

21.75

Weight (kDa)

8.37

Isoelectric Point (pI)

66.72

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000120)

Species	Orthologous Gene IDs
malus_domestica	MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica	Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis	pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	570
AccB1I	GGYRCC	1 cut(s)	366
AccB7I	CCANNNNNTGG	2 cut(s)	393, 454
AccBSI	CCGCTC	2 cut(s)	168, 440
AciI	CCGC	2 cut(s)	166, 438
AclWI	GGATC	2 cut(s)	214, 439
AcoI	YGGCCR	2 cut(s)	90, 395
AcuI	CTGAAG	2 cut(s)	251, 336
AcyI	GRCGYC	1 cut(s)	9
AdeI	CACNNNGTG	2 cut(s)	116, 454
AfiI	CCNNNNNNNGG	3 cut(s)	178, 393, 454
AgsI	TTSAA	3 cut(s)	98, 329, 493
AjnI	CCWGG	2 cut(s)	376, 410
AluBI	AGCT	6 cut(s)	20, 32, 229, 304, 425, 556
AluI	AGCT	6 cut(s)	20, 32, 229, 304, 425, 556
Alw26I	GTCTC	1 cut(s)	212
AlwI	GGATC	2 cut(s)	214, 439
AlwNI	CAGNNNCTG	1 cut(s)	229
AoxI	GGCC	5 cut(s)	90, 148, 395, 408, 458
ApeKI	GCWGC	3 cut(s)	64, 226, 304
ArsI	GACNNNNNNTTYG	2 cut(s)	322, 354
AspS9I	GGNCC	3 cut(s)	78, 148, 458
AvaII	GGWCC	1 cut(s)	78
BalI	TGGCCA	1 cut(s)	397
BanI	GGYRCC	1 cut(s)	366
BbvI	GCAGC	3 cut(s)	51, 238, 291
BccI	CCATC	1 cut(s)	184
BceAI	ACGGC	1 cut(s)	77
BciT130I	CCWGG	2 cut(s)	378, 412
BcoDI	GTCTC	1 cut(s)	212
BfaI	CTAG	2 cut(s)	33, 422
BisI	GCNGC	3 cut(s)	65, 227, 305
BlsI	GCNGC	3 cut(s)	66, 228, 306
Bme1390I	CCNGG	2 cut(s)	378, 412
Bme18I	GGWCC	1 cut(s)	78
BmgT120I	GGNCC	3 cut(s)	78, 148, 458
BmiI	GGNNCC	3 cut(s)	38, 368, 459
BmrFI	CCNGG	2 cut(s)	378, 412
BmsI	GCATC	1 cut(s)	420
BpmI	CTGGAG	1 cut(s)	344
BpuEI	CTTGAG	2 cut(s)	194, 447
BsaAI	YACGTR	1 cut(s)	451
BsaHI	GRCGYC	1 cut(s)	9
BsaJI	CCNNGG	1 cut(s)	377
Bsc4I	CCNNNNNNNGG	3 cut(s)	178, 393, 454
BseBI	CCWGG	2 cut(s)	378, 412
BseDI	CCNNGG	1 cut(s)	377
BseGI	GGATG	1 cut(s)	383
BseLI	CCNNNNNNNGG	3 cut(s)	178, 393, 454
BseRI	GAGGAG	1 cut(s)	32
BseXI	GCAGC	3 cut(s)	51, 238, 291
Bsh1285I	CGRYCG	1 cut(s)	337
BshFI	GGCC	5 cut(s)	92, 150, 397, 410, 460
BshNI	GGYRCC	1 cut(s)	366
BsiEI	CGRYCG	1 cut(s)	337
BslFI	GGGAC	1 cut(s)	88
BslI	CCNNNNNNNGG	3 cut(s)	178, 393, 454
BsmAI	GTCTC	1 cut(s)	212
BsmFI	GGGAC	1 cut(s)	88
BsmI	GAATGC	2 cut(s)	421, 527
BsnI	GGCC	5 cut(s)	92, 150, 397, 410, 460
Bsp143I	GATC	2 cut(s)	219, 444
BspACI	CCGC	2 cut(s)	166, 438
BspANI	GGCC	5 cut(s)	92, 150, 397, 410, 460
BspLI	GGNNCC	3 cut(s)	38, 368, 459
BspPI	GGATC	2 cut(s)	214, 439
BspT107I	GGYRCC	1 cut(s)	366
BsrBI	CCGCTC	2 cut(s)	168, 440
BssECI	CCNNGG	1 cut(s)	377
BssMI	GATC	2 cut(s)	219, 444
BssNI	GRCGYC	1 cut(s)	9
Bst2UI	CCWGG	2 cut(s)	378, 412
Bst4CI	ACNGT	2 cut(s)	78, 338
Bst6I	CTCTTC	2 cut(s)	281, 525
BstACI	GRCGYC	1 cut(s)	9
BstBAI	YACGTR	1 cut(s)	451
BstC8I	GCNNGC	5 cut(s)	158, 162, 166, 261, 482
BstDEI	CTNAG	1 cut(s)	113
BstF5I	GGATG	1 cut(s)	383
BstKTI	GATC	2 cut(s)	222, 447
BstMAI	GTCTC	1 cut(s)	212
BstMBI	GATC	2 cut(s)	219, 444
BstMCI	CGRYCG	1 cut(s)	337
BstMWI	GCNNNNNNNGC	2 cut(s)	17, 416
BstNI	CCWGG	2 cut(s)	378, 412
BstNSI	RCATGY	2 cut(s)	259, 484
BstSCI	CCNGG	2 cut(s)	376, 410
BstV1I	GCAGC	3 cut(s)	51, 238, 291
BstX2I	RGATCY	1 cut(s)	219
BstYI	RGATCY	1 cut(s)	219
BsuRI	GGCC	5 cut(s)	92, 150, 397, 410, 460
BtsCI	GGATG	1 cut(s)	383
BtsIMutI	CAGTG	1 cut(s)	128
Cac8I	GCNNGC	5 cut(s)	158, 162, 166, 261, 482
CaiI	CAGNNNCTG	1 cut(s)	229
Cfr13I	GGNCC	3 cut(s)	78, 148, 458
CpoI	CGGWCCG	1 cut(s)	78
CseI	GACGC	1 cut(s)	17
CspI	CGGWCCG	1 cut(s)	78
CviAII	CATG	5 cut(s)	145, 256, 283, 481, 518
DdeI	CTNAG	1 cut(s)	113
DpnI	GATC	2 cut(s)	221, 446
DpnII	GATC	2 cut(s)	219, 444
DraIII	CACNNNGTG	2 cut(s)	116, 454
EaeI	YGGCCR	2 cut(s)	90, 395
Eam1104I	CTCTTC	2 cut(s)	281, 525
EarI	CTCTTC	2 cut(s)	281, 525
Eco147I	AGGCCT	1 cut(s)	410
Eco47I	GGWCC	1 cut(s)	78
Eco57I	CTGAAG	2 cut(s)	251, 336
EcoO109I	RGGNCCY	1 cut(s)	458
EcoRII	CCWGG	2 cut(s)	376, 410
EcoT22I	ATGCAT	1 cut(s)	527
FaeI	CATG	5 cut(s)	148, 259, 286, 484, 521
FaiI	YATR	9 cut(s)	146, 237, 257, 284, 482, 519, 527, 561, 570
FaqI	GGGAC	1 cut(s)	88
FatI	CATG	5 cut(s)	144, 255, 282, 480, 517
FauI	CCCGC	2 cut(s)	173, 445
Fnu4HI	GCNGC	3 cut(s)	65, 227, 305
FokI	GGATG	1 cut(s)	370
Fsp4HI	GCNGC	3 cut(s)	65, 227, 305
FspBI	CTAG	2 cut(s)	33, 422
GluI	GCNGC	3 cut(s)	65, 227, 305
GsuI	CTGGAG	1 cut(s)	344
HaeIII	GGCC	5 cut(s)	92, 150, 397, 410, 460
HgaI	GACGC	1 cut(s)	17
Hin1I	GRCGYC	1 cut(s)	9
Hin1II	CATG	5 cut(s)	148, 259, 286, 484, 521
HinfI	GANTC	5 cut(s)	101, 182, 311, 325, 546
Hpy188I	TCNGA	6 cut(s)	82, 316, 324, 342, 429, 444
Hpy188III	TCNNGA	3 cut(s)	72, 98, 361
Hpy99I	CGWCG	1 cut(s)	280
HpyAV	CCTTC	1 cut(s)	311
HpyCH4III	ACNGT	2 cut(s)	78, 338
HpyCH4IV	ACGT	1 cut(s)	450
HpyCH4V	TGCA	6 cut(s)	4, 253, 263, 307, 480, 525
HpyF10VI	GCNNNNNNNGC	2 cut(s)	17, 416
HpyF3I	CTNAG	1 cut(s)	113
HpySE526I	ACGT	1 cut(s)	450
Hsp92I	GRCGYC	1 cut(s)	9
Hsp92II	CATG	5 cut(s)	148, 259, 286, 484, 521
Kzo9I	GATC	2 cut(s)	219, 444
LmnI	GCTCC	3 cut(s)	173, 430, 445
Lsp1109I	GCAGC	3 cut(s)	51, 238, 291
LweI	GCATC	1 cut(s)	420
MaeI	CTAG	2 cut(s)	33, 422
MaeII	ACGT	1 cut(s)	450
MalI	GATC	2 cut(s)	221, 446
MbiI	CCGCTC	2 cut(s)	168, 440
MboI	GATC	2 cut(s)	219, 444
MboII	GAAGA	2 cut(s)	298, 542
MflI	RGATCY	1 cut(s)	219
MlsI	TGGCCA	1 cut(s)	397
MluCI	AATT	2 cut(s)	488, 565
MluNI	TGGCCA	1 cut(s)	397
MlyI	GAGTC	2 cut(s)	110, 320
MmeI	TCCRAC	2 cut(s)	165, 302
Mox20I	TGGCCA	1 cut(s)	397
Mph1103I	ATGCAT	1 cut(s)	527
MscI	TGGCCA	1 cut(s)	397
MseI	TTAA	1 cut(s)	552
Msp20I	TGGCCA	1 cut(s)	397
MspA1I	CMGCKG	1 cut(s)	229
MspR9I	CCNGG	2 cut(s)	378, 412
Mva1269I	GAATGC	2 cut(s)	421, 527
MvaI	CCWGG	2 cut(s)	378, 412
MwoI	GCNNNNNNNGC	2 cut(s)	17, 416
NdeII	GATC	2 cut(s)	219, 444
NlaIII	CATG	5 cut(s)	148, 259, 286, 484, 521
NlaIV	GGNNCC	3 cut(s)	38, 368, 459
NsiI	ATGCAT	1 cut(s)	527
NspI	RCATGY	2 cut(s)	259, 484
PaeI	GCATGC	1 cut(s)	484
PceI	AGGCCT	1 cut(s)	410
PctI	GAATGC	2 cut(s)	421, 527
PfeI	GAWTC	3 cut(s)	182, 325, 546
PflMI	CCANNNNNTGG	2 cut(s)	393, 454
PkrI	GCNGC	3 cut(s)	66, 228, 306
PleI	GAGTC	2 cut(s)	109, 319
PpsI	GAGTC	2 cut(s)	109, 319
Ppu21I	YACGTR	1 cut(s)	451
PsiI	TTATAA	1 cut(s)	570
Psp6I	CCWGG	2 cut(s)	376, 410
PspGI	CCWGG	2 cut(s)	376, 410
PspN4I	GGNNCC	3 cut(s)	38, 368, 459
PspPI	GGNCC	3 cut(s)	78, 148, 458
PstNI	CAGNNNCTG	1 cut(s)	229
PsuI	RGATCY	1 cut(s)	219
PvuII	CAGCTG	1 cut(s)	229
Rsr2I	CGGWCCG	1 cut(s)	78
RsrII	CGGWCCG	1 cut(s)	78
SaqAI	TTAA	1 cut(s)	552
SatI	GCNGC	3 cut(s)	65, 227, 305
Sau3AI	GATC	2 cut(s)	219, 444
Sau96I	GGNCC	3 cut(s)	78, 148, 458
SchI	GAGTC	2 cut(s)	110, 320
ScrFI	CCNGG	2 cut(s)	378, 412
SfaNI	GCATC	1 cut(s)	420
SinI	GGWCC	1 cut(s)	78
SmlI	CTYRAG	2 cut(s)	209, 462
SmoI	CTYRAG	2 cut(s)	209, 462
SphI	GCATGC	1 cut(s)	484
Sse9I	AATT	2 cut(s)	488, 565
SseBI	AGGCCT	1 cut(s)	410
SsiI	CCGC	2 cut(s)	166, 438
SspMI	CTAG	2 cut(s)	33, 422
StuI	AGGCCT	1 cut(s)	410
StyD4I	CCNGG	2 cut(s)	376, 410
TaaI	ACNGT	2 cut(s)	78, 338
TaiI	ACGT	1 cut(s)	453
TaqI	TCGA	1 cut(s)	275
TasI	AATT	2 cut(s)	488, 565
TfiI	GAWTC	3 cut(s)	182, 325, 546
Tru1I	TTAA	1 cut(s)	552
Tru9I	TTAA	1 cut(s)	552
TscAI	CASTG	1 cut(s)	128
TseI	GCWGC	3 cut(s)	64, 226, 304
TspDTI	ATGAA	3 cut(s)	299, 534, 576
TspRI	CASTG	1 cut(s)	128
Van91I	CCANNNNNTGG	2 cut(s)	393, 454
VpaK11BI	GGWCC	1 cut(s)	78
XceI	RCATGY	2 cut(s)	259, 484
XspI	CTAG	2 cut(s)	33, 422
Zsp2I	ATGCAT	1 cut(s)	527

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.