pycom13g26010

Nudix hydrolase 3-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
Physical Location & Seq
Forward (+)
22731002 .. 22735666
4665 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom13g26010.1

Sequence Viewer

Length: 795 bp
ATGGCTCGAGTCTCACAGGGTTGTAGCATTTGTTTGAGTTCCTTCCTTCAAGCATGTTACAAAAACGAATTTTTCTTTTATGATTGCATGGCTAACCCATCTAACCTTTGCTTAGATTTGAGTCTCAGCAGTGATACGGTTGCGCTGCGTCAAGGTAATGTATGGCGCCCTTCTTTCTTATCTTCTAATGGCCCTCTTACAGGTGAAGACTCCATGATGAAGGATGCAACAACAGCTACGATAGTAGCTAGGAACCTCCTCACTCCAAAAGATAGTAGGCTGCTTTCAGAACGGTCCGATGAGTTGGCCGTTCAAGAGTCCCTAGCTCTCAGCGTTCAGTGTGCGGGCTCTGTGTCCAACATGGGCCAACGCCTACTTGCTCGATCCCGCCAAGTTGAATCCTTGATGGCGGAGGTGGAAAGTCTTAAGCAAGAGATCAAACAGCTTAAGCACGAGAATAGAAGTTTGCACGTGCTTGCAAATAACTATTCGACAAGCATGAAGAGGAAGCTTGATGAGCTGCAAGAATCTAATGGTCAAATTCAAAGTGACCGTCAAAGGCTTGCGGCTTTCTTCCAGAGGCACCTTTTTCCTGGCTCATCTAGCGTTCCACCAAGTGTTGAGGCCTCGAATGATCCATCTTCGATGTCTCCCGCTCCTGGAGTTTTGCCAAGTACTGGGGCTTCACGTAAACGACCTTTCATTATCAAACAAAGAGAATTGAATTTAAACATTGAAATCAAAGAAACACCTAAACATTCCAACAACTCAAACTTGAATTGTATGAACGTTTAG

Protein Analysis

265

Amino Acids

29.19

Weight (kDa)

8.47

Isoelectric Point (pI)

64.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 165, 582
AccB7I CCANNNNNTGG 1 cut(s) 677
AccBSI CCGCTC 1 cut(s) 656
AciI CCGC 5 cut(s) 344, 388, 410, 566, 654
AclI AACGTT 1 cut(s) 789
AclWI GGATC 2 cut(s) 378, 629
AcoI YGGCCR 1 cut(s) 306
AcsI RAATTY 3 cut(s) 68, 540, 724
AcvI CACGTG 1 cut(s) 472
AcyI GRCGYC 1 cut(s) 166
AdeI CACNNNGTG 1 cut(s) 617
AfaI GTAC 1 cut(s) 676
AfiI CCNNNNNNNGG 3 cut(s) 200, 659, 677
AflII CTTAAG 2 cut(s) 425, 446
AgsI TTSAA 7 cut(s) 50, 314, 398, 545, 724, 737, 778
AjnI CCWGG 2 cut(s) 592, 658
AluBI AGCT 6 cut(s) 236, 248, 326, 445, 511, 520
AluI AGCT 6 cut(s) 236, 248, 326, 445, 511, 520
Alw26I GTCTC 3 cut(s) 16, 128, 654
AlwI GGATC 2 cut(s) 378, 629
Ama87I CYCGRG 1 cut(s) 6
AoxI GGCC 4 cut(s) 190, 306, 364, 624
ApeKI GCWGC 3 cut(s) 145, 280, 520
ApoI RAATTY 3 cut(s) 68, 540, 724
ArsI GACNNNNNNTTYG 2 cut(s) 538, 570
AspLEI GCGC 2 cut(s) 145, 168
AspS9I GGNCC 3 cut(s) 191, 294, 364
AsuHPI GGTGA 1 cut(s) 215
AvaI CYCGRG 1 cut(s) 6
AvaII GGWCC 1 cut(s) 294
BanI GGYRCC 2 cut(s) 165, 582
BanII GRGCYC 1 cut(s) 350
BarI GAAGNNNNNNTAC 2 cut(s) 667, 699
BauI CACGAG 1 cut(s) 452
BbrPI CACGTG 1 cut(s) 472
BbsI GAAGAC 1 cut(s) 213
BbvI GCAGC 3 cut(s) 132, 267, 507
BccI CCATC 3 cut(s) 106, 400, 646
BceAI ACGGC 1 cut(s) 293
BciT130I CCWGG 2 cut(s) 594, 660
BcoDI GTCTC 3 cut(s) 16, 128, 654
BfaI CTAG 3 cut(s) 249, 323, 603
BfoI RGCGCY 1 cut(s) 169
BfrI CTTAAG 2 cut(s) 425, 446
BisI GCNGC 4 cut(s) 146, 281, 521, 567
BlsI GCNGC 4 cut(s) 147, 282, 522, 568
BmcAI AGTACT 1 cut(s) 676
Bme1390I CCNGG 2 cut(s) 594, 660
Bme18I GGWCC 1 cut(s) 294
BmeT110I CYCGRG 1 cut(s) 6
BmgT120I GGNCC 3 cut(s) 191, 294, 364
BmiI GGNNCC 3 cut(s) 167, 254, 584
BmrFI CCNGG 2 cut(s) 594, 660
BmrI ACTGGG 1 cut(s) 687
BmsI GCATC 1 cut(s) 214
BmuI ACTGGG 1 cut(s) 687
BpiI GAAGAC 1 cut(s) 213
BpmI CTGGAG 1 cut(s) 681
BsaAI YACGTR 2 cut(s) 472, 689
BsaHI GRCGYC 1 cut(s) 166
Bsc4I CCNNNNNNNGG 3 cut(s) 200, 659, 677
Bse1I ACTGG 1 cut(s) 682
BseBI CCWGG 2 cut(s) 594, 660
BseGI GGATG 1 cut(s) 229
BseLI CCNNNNNNNGG 3 cut(s) 200, 659, 677
BseMII CTCAG 2 cut(s) 139, 343
BseNI ACTGG 1 cut(s) 682
BseRI GAGGAG 1 cut(s) 248
BseXI GCAGC 3 cut(s) 132, 267, 507
BshFI GGCC 4 cut(s) 192, 308, 366, 626
BshNI GGYRCC 2 cut(s) 165, 582
BsiHKCI CYCGRG 1 cut(s) 6
BslFI GGGAC 1 cut(s) 304
BslI CCNNNNNNNGG 3 cut(s) 200, 659, 677
BsmAI GTCTC 3 cut(s) 16, 128, 654
BsmFI GGGAC 1 cut(s) 304
BsnI GGCC 4 cut(s) 192, 308, 366, 626
BsoBI CYCGRG 1 cut(s) 6
Bsp1286I GDGCHC 1 cut(s) 350
Bsp143I GATC 3 cut(s) 383, 435, 634
BspACI CCGC 5 cut(s) 344, 388, 410, 566, 654
BspANI GGCC 4 cut(s) 192, 308, 366, 626
BspCNI CTCAG 2 cut(s) 138, 342
BspLI GGNNCC 3 cut(s) 167, 254, 584
BspPI GGATC 2 cut(s) 378, 629
BspT107I GGYRCC 2 cut(s) 165, 582
BspTI CTTAAG 2 cut(s) 425, 446
BsrBI CCGCTC 1 cut(s) 656
BsrI ACTGG 1 cut(s) 682
BssMI GATC 3 cut(s) 383, 435, 634
BssNI GRCGYC 1 cut(s) 166
BssSI CACGAG 1 cut(s) 452
Bst2BI CACGAG 1 cut(s) 452
Bst2UI CCWGG 2 cut(s) 594, 660
Bst4CI ACNGT 3 cut(s) 139, 294, 554
Bst6I CTCTTC 1 cut(s) 497
BstACI GRCGYC 1 cut(s) 166
BstAFI CTTAAG 2 cut(s) 425, 446
BstBAI YACGTR 2 cut(s) 472, 689
BstC8I GCNNGC 3 cut(s) 346, 477, 564
BstDEI CTNAG 3 cut(s) 112, 125, 329
BstENI CCTNNNNNAGG 1 cut(s) 198
BstF5I GGATG 1 cut(s) 229
BstH2I RGCGCY 1 cut(s) 169
BstHHI GCGC 2 cut(s) 145, 168
BstKTI GATC 3 cut(s) 386, 438, 637
BstMAI GTCTC 3 cut(s) 16, 128, 654
BstMBI GATC 3 cut(s) 383, 435, 634
BstMWI GCNNNNNNNGC 3 cut(s) 233, 517, 603
BstNI CCWGG 2 cut(s) 594, 660
BstNSI RCATGY 1 cut(s) 57
BstSCI CCNGG 2 cut(s) 592, 658
BstV1I GCAGC 3 cut(s) 132, 267, 507
BstV2I GAAGAC 1 cut(s) 213
BsuRI GGCC 4 cut(s) 192, 308, 366, 626
BtsCI GGATG 1 cut(s) 229
BtsI GCAGTG 1 cut(s) 136
BtsIMutI CAGTG 2 cut(s) 136, 344
Cac8I GCNNGC 3 cut(s) 346, 477, 564
CfoI GCGC 2 cut(s) 145, 168
Cfr13I GGNCC 3 cut(s) 191, 294, 364
CpoI CGGWCCG 1 cut(s) 294
CseI GACGC 1 cut(s) 137
Csp6I GTAC 1 cut(s) 675
CspI CGGWCCG 1 cut(s) 294
CviAII CATG 5 cut(s) 54, 88, 214, 361, 499
CviQI GTAC 1 cut(s) 675
DdeI CTNAG 3 cut(s) 112, 125, 329
DinI GGCGCC 1 cut(s) 167
DpnI GATC 3 cut(s) 385, 437, 636
DpnII GATC 3 cut(s) 383, 435, 634
DraI TTTAAA 1 cut(s) 729
DraIII CACNNNGTG 1 cut(s) 617
EaeI YGGCCR 1 cut(s) 306
Eam1104I CTCTTC 1 cut(s) 497
EarI CTCTTC 1 cut(s) 497
EciI GGCGGA 1 cut(s) 425
Eco147I AGGCCT 1 cut(s) 626
Eco24I GRGCYC 1 cut(s) 350
Eco47I GGWCC 1 cut(s) 294
Eco72I CACGTG 1 cut(s) 472
Eco88I CYCGRG 1 cut(s) 6
EcoNI CCTNNNNNAGG 1 cut(s) 198
EcoRII CCWGG 2 cut(s) 592, 658
EcoT38I GRGCYC 1 cut(s) 350
EgeI GGCGCC 1 cut(s) 167
EheI GGCGCC 1 cut(s) 167
FaeI CATG 5 cut(s) 57, 91, 217, 364, 502
FaiI YATR 8 cut(s) 55, 81, 89, 163, 215, 362, 500, 785
FaqI GGGAC 1 cut(s) 304
FatI CATG 5 cut(s) 53, 87, 213, 360, 498
FauI CCCGC 3 cut(s) 337, 395, 661
Fnu4HI GCNGC 4 cut(s) 146, 281, 521, 567
FokI GGATG 1 cut(s) 236
FriOI GRGCYC 1 cut(s) 350
Fsp4HI GCNGC 4 cut(s) 146, 281, 521, 567
FspBI CTAG 3 cut(s) 249, 323, 603
GlaI GCGC 2 cut(s) 144, 167
GluI GCNGC 4 cut(s) 146, 281, 521, 567
GsuI CTGGAG 1 cut(s) 681
HaeII RGCGCY 1 cut(s) 169
HaeIII GGCC 4 cut(s) 192, 308, 366, 626
HgaI GACGC 1 cut(s) 137
HhaI GCGC 2 cut(s) 145, 168
Hin1I GRCGYC 1 cut(s) 166
Hin1II CATG 5 cut(s) 57, 91, 217, 364, 502
Hin6I GCGC 2 cut(s) 143, 166
HinP1I GCGC 2 cut(s) 143, 166
HindIII AAGCTT 1 cut(s) 509
HinfI GANTC 6 cut(s) 9, 121, 209, 317, 398, 527
HphI GGTGA 1 cut(s) 215
Hpy166II GTNNAC 1 cut(s) 692
Hpy188I TCNGA 2 cut(s) 289, 298
Hpy188III TCNNGA 2 cut(s) 314, 577
Hpy8I GTNNAC 1 cut(s) 692
HpyAV CCTTC 4 cut(s) 52, 56, 180, 214
HpyCH4III ACNGT 3 cut(s) 139, 294, 554
HpyCH4IV ACGT 3 cut(s) 471, 688, 789
HpyCH4V TGCA 5 cut(s) 87, 227, 469, 479, 523
HpyF10VI GCNNNNNNNGC 3 cut(s) 233, 517, 603
HpyF3I CTNAG 3 cut(s) 112, 125, 329
HpySE526I ACGT 3 cut(s) 471, 688, 789
Hsp92I GRCGYC 1 cut(s) 166
Hsp92II CATG 5 cut(s) 57, 91, 217, 364, 502
HspAI GCGC 2 cut(s) 143, 166
KasI GGCGCC 1 cut(s) 165
Kzo9I GATC 3 cut(s) 383, 435, 634
LmnI GCTCC 1 cut(s) 661
LpnPI CCDG 8 cut(s) 2, 186, 579, 590, 606, 645, 663, 672
Lsp1109I GCAGC 3 cut(s) 132, 267, 507
LweI GCATC 1 cut(s) 214
MaeI CTAG 3 cut(s) 249, 323, 603
MaeII ACGT 3 cut(s) 471, 688, 789
MaeIII GTNAC 2 cut(s) 56, 548
MalI GATC 3 cut(s) 385, 437, 636
MbiI CCGCTC 1 cut(s) 656
MboI GATC 3 cut(s) 383, 435, 634
MboII GAAGA 5 cut(s) 174, 218, 514, 565, 633
MhlI GDGCHC 1 cut(s) 350
MluCI AATT 5 cut(s) 68, 540, 719, 724, 778
Mly113I GGCGCC 1 cut(s) 166
MlyI GAGTC 4 cut(s) 18, 130, 203, 326
MmeI TCCRAC 2 cut(s) 381, 786
MnlI CCTC 8 cut(s) 204, 266, 269, 406, 498, 573, 616, 637
MseI TTAA 3 cut(s) 426, 447, 728
MspCI CTTAAG 2 cut(s) 425, 446
MspR9I CCNGG 2 cut(s) 594, 660
MvaI CCWGG 2 cut(s) 594, 660
MwoI GCNNNNNNNGC 3 cut(s) 233, 517, 603
NarI GGCGCC 1 cut(s) 166
NdeII GATC 3 cut(s) 383, 435, 634
NlaIII CATG 5 cut(s) 57, 91, 217, 364, 502
NlaIV GGNNCC 3 cut(s) 167, 254, 584
NmuCI GTSAC 1 cut(s) 548
NspI RCATGY 1 cut(s) 57
PaeR7I CTCGAG 1 cut(s) 6
PceI AGGCCT 1 cut(s) 626
PfeI GAWTC 2 cut(s) 398, 527
PflMI CCANNNNNTGG 1 cut(s) 677
PfoI TCCNGGA 1 cut(s) 658
PkrI GCNGC 4 cut(s) 147, 282, 522, 568
PleI GAGTC 4 cut(s) 17, 129, 203, 325
PluTI GGCGCC 1 cut(s) 169
PmaCI CACGTG 1 cut(s) 472
PmlI CACGTG 1 cut(s) 472
PpsI GAGTC 4 cut(s) 17, 129, 203, 325
Ppu21I YACGTR 2 cut(s) 472, 689
Psp1406I AACGTT 1 cut(s) 789
Psp6I CCWGG 2 cut(s) 592, 658
PspCI CACGTG 1 cut(s) 472
PspGI CCWGG 2 cut(s) 592, 658
PspN4I GGNNCC 3 cut(s) 167, 254, 584
PspPI GGNCC 3 cut(s) 191, 294, 364
PspXI VCTCGAGB 1 cut(s) 6
RsaI GTAC 1 cut(s) 676
RsaNI GTAC 1 cut(s) 675
Rsr2I CGGWCCG 1 cut(s) 294
RsrII CGGWCCG 1 cut(s) 294
SaqAI TTAA 3 cut(s) 426, 447, 728
SatI GCNGC 4 cut(s) 146, 281, 521, 567
Sau3AI GATC 3 cut(s) 383, 435, 634
Sau96I GGNCC 3 cut(s) 191, 294, 364
ScaI AGTACT 1 cut(s) 676
SchI GAGTC 4 cut(s) 18, 130, 203, 326
ScrFI CCNGG 2 cut(s) 594, 660
SduI GDGCHC 1 cut(s) 350
SfaNI GCATC 1 cut(s) 214
SfoI GGCGCC 1 cut(s) 167
Sfr274I CTCGAG 1 cut(s) 6
SinI GGWCC 1 cut(s) 294
SlaI CTCGAG 1 cut(s) 6
SmlI CTYRAG 3 cut(s) 6, 425, 446
SmoI CTYRAG 3 cut(s) 6, 425, 446
Sse9I AATT 5 cut(s) 68, 540, 719, 724, 778
SseBI AGGCCT 1 cut(s) 626
SsiI CCGC 5 cut(s) 344, 388, 410, 566, 654
SspDI GGCGCC 1 cut(s) 165
SspMI CTAG 3 cut(s) 249, 323, 603
StuI AGGCCT 1 cut(s) 626
StyD4I CCNGG 2 cut(s) 592, 658
TaaI ACNGT 3 cut(s) 139, 294, 554
TaiI ACGT 3 cut(s) 474, 691, 792
TaqI TCGA 5 cut(s) 7, 382, 491, 629, 644
TasI AATT 5 cut(s) 68, 540, 719, 724, 778
TatI WGTACW 1 cut(s) 674
TauI GCSGC 1 cut(s) 569
TfiI GAWTC 2 cut(s) 398, 527
Tru1I TTAA 3 cut(s) 426, 447, 728
Tru9I TTAA 3 cut(s) 426, 447, 728
TscAI CASTG 2 cut(s) 136, 344
TseFI GTSAC 1 cut(s) 548
TseI GCWGC 3 cut(s) 145, 280, 520
Tsp45I GTSAC 1 cut(s) 548
TspDTI ATGAA 3 cut(s) 233, 515, 691
TspRI CASTG 2 cut(s) 136, 344
Van91I CCANNNNNTGG 1 cut(s) 677
Vha464I CTTAAG 2 cut(s) 425, 446
VpaK11BI GGWCC 1 cut(s) 294
XagI CCTNNNNNAGG 1 cut(s) 198
XapI RAATTY 3 cut(s) 68, 540, 724
XceI RCATGY 1 cut(s) 57
XhoI CTCGAG 1 cut(s) 6
XspI CTAG 3 cut(s) 249, 323, 603
ZrmI AGTACT 1 cut(s) 676
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.