Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr6

Orthogroup ID

OG0000120

Physical Location & Seq

Genomic Coordinates Forward (+)

15315075 .. 15317206

Gene Structure 2132 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom06g09990.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 561 bp

ATGAATCAGCACATGTATTTGTTGTGCTTGTTTCCACATGCATCGATCTACCGTTTCCTTCTGGCTCATCTGTACTCCAGGTATCTGGTATCATCTTTGGGGAAGAAGAAAAAATTGAGTATTTCGAAAGGCTTTGCTGGGAGTGCGCCCTCAGAGGTGAGGAAGAGTTGGGCGCGACGGTCCGATGAGTTGGCCGTTCAAGAGTCCCTCGCTCTTAGTGTTCAGTGTGCGAGCTCTGTGTCCAACATGGGCCAACGCCTGCTTGCTCGGTCCCGTCAGGTGGAATCATTGATGGCAGAGGTGGAAAATCTTAAGCAGGAGAACAAACAGCTTAAGTACGAGAATAGAAGTTTGCACGTGCTTGCAAATAACTATTCGTCGGGCATGAAGAGGAAACTTGATGAGCTGCAAGAATCTGAAGGCCGAATTCAAAGTGACCGTCAAAGGTTTGCGGCTTTCCTCCAGAGGCACATTTTTCCTGGGTCATCTAGCGTTCCACCAAGAGTTAACGGCGGCAAAGACGGCAAGGATGGTTGCTGCTGCAATCGGTGGAGGCGTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004177 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005829 GO:0006508 GO:0006807 GO:0008150 GO:0008152 GO:0008233 GO:0008238 GO:0008239 GO:0016787 GO:0019538 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044238 GO:0044424 GO:0044444 GO:0044464 GO:0070011 GO:0071704 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

NUDIX Peptidase_M49

Protein Analysis

187

Amino Acids

21.17

Weight (kDa)

9.98

Isoelectric Point (pI)

59.09

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000120)

Species	Orthologous Gene IDs
malus_domestica	MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica	Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis	pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	1 cut(s)	175
AciI	CCGC	2 cut(s)	452, 513
AcoI	YGGCCR	1 cut(s)	192
AcsI	RAATTY	1 cut(s)	426
AcuI	CTGAAG	1 cut(s)	438
AcvI	CACGTG	1 cut(s)	358
AfaI	GTAC	2 cut(s)	74, 338
AfiI	CCNNNNNNNGG	1 cut(s)	280
AflII	CTTAAG	2 cut(s)	311, 332
AflIII	ACRYGT	1 cut(s)	12
AgsI	TTSAA	2 cut(s)	200, 431
AjnI	CCWGG	2 cut(s)	77, 478
AluBI	AGCT	3 cut(s)	234, 331, 406
AluI	AGCT	3 cut(s)	234, 331, 406
Alw21I	GWGCWC	1 cut(s)	236
AoxI	GGCC	3 cut(s)	192, 250, 421
ApeKI	GCWGC	3 cut(s)	406, 537, 540
ApoI	RAATTY	1 cut(s)	426
ArsI	GACNNNNNNTTYG	2 cut(s)	424, 456
AspLEI	GCGC	2 cut(s)	148, 175
AspS9I	GGNCC	3 cut(s)	180, 250, 270
AsuHPI	GGTGA	1 cut(s)	169
AsuII	TTCGAA	1 cut(s)	125
AvaII	GGWCC	2 cut(s)	180, 270
BanII	GRGCYC	1 cut(s)	236
BbrPI	CACGTG	1 cut(s)	358
Bbv12I	GWGCWC	1 cut(s)	236
BbvI	GCAGC	3 cut(s)	393, 524, 527
BccI	CCATC	2 cut(s)	286, 524
BceAI	ACGGC	3 cut(s)	179, 526, 538
BciT130I	CCWGG	2 cut(s)	79, 480
BfaI	CTAG	1 cut(s)	489
BfrI	CTTAAG	2 cut(s)	311, 332
BisI	GCNGC	5 cut(s)	407, 453, 514, 538, 541
BlsI	GCNGC	5 cut(s)	408, 454, 515, 539, 542
Bme1390I	CCNGG	2 cut(s)	79, 480
Bme18I	GGWCC	2 cut(s)	180, 270
BmgT120I	GGNCC	3 cut(s)	180, 250, 270
BmiI	GGNNCC	1 cut(s)	272
BmrFI	CCNGG	2 cut(s)	79, 480
BmsI	GCATC	1 cut(s)	50
BpmI	CTGGAG	2 cut(s)	61, 446
Bpu14I	TTCGAA	1 cut(s)	125
Bsa29I	ATCGAT	1 cut(s)	44
BsaAI	YACGTR	1 cut(s)	358
BsaJI	CCNNGG	1 cut(s)	479
Bsc4I	CCNNNNNNNGG	1 cut(s)	280
BseBI	CCWGG	2 cut(s)	79, 480
BseCI	ATCGAT	1 cut(s)	44
BseDI	CCNNGG	1 cut(s)	479
BseGI	GGATG	1 cut(s)	535
BseLI	CCNNNNNNNGG	1 cut(s)	280
BseMII	CTCAG	1 cut(s)	165
BseXI	GCAGC	3 cut(s)	393, 524, 527
BseYI	CCCAGC	1 cut(s)	137
Bsh1236I	CGCG	1 cut(s)	175
BshFI	GGCC	3 cut(s)	194, 252, 423
BshVI	ATCGAT	1 cut(s)	44
BsiHKAI	GWGCWC	1 cut(s)	236
BslFI	GGGAC	2 cut(s)	190, 256
BslI	CCNNNNNNNGG	1 cut(s)	280
BsmFI	GGGAC	2 cut(s)	190, 256
BsnI	GGCC	3 cut(s)	194, 252, 423
Bsp119I	TTCGAA	1 cut(s)	125
Bsp1286I	GDGCHC	1 cut(s)	236
Bsp143I	GATC	1 cut(s)	45
BspACI	CCGC	2 cut(s)	452, 513
BspANI	GGCC	3 cut(s)	194, 252, 423
BspCNI	CTCAG	1 cut(s)	164
BspDI	ATCGAT	1 cut(s)	44
BspFNI	CGCG	1 cut(s)	175
BspLI	GGNNCC	1 cut(s)	272
BspT104I	TTCGAA	1 cut(s)	125
BspTI	CTTAAG	2 cut(s)	311, 332
BssECI	CCNNGG	1 cut(s)	479
BssMI	GATC	1 cut(s)	45
Bst2UI	CCWGG	2 cut(s)	79, 480
Bst4CI	ACNGT	3 cut(s)	53, 180, 440
Bst6I	CTCTTC	2 cut(s)	158, 383
BstAFI	CTTAAG	2 cut(s)	311, 332
BstBAI	YACGTR	1 cut(s)	358
BstBI	TTCGAA	1 cut(s)	125
BstC8I	GCNNGC	4 cut(s)	232, 260, 264, 363
BstDEI	CTNAG	2 cut(s)	151, 215
BstF5I	GGATG	1 cut(s)	535
BstFNI	CGCG	1 cut(s)	175
BstHHI	GCGC	2 cut(s)	148, 175
BstKTI	GATC	1 cut(s)	48
BstMBI	GATC	1 cut(s)	45
BstMWI	GCNNNNNNNGC	2 cut(s)	143, 522
BstNI	CCWGG	2 cut(s)	79, 480
BstNSI	RCATGY	2 cut(s)	16, 41
BstSCI	CCNGG	2 cut(s)	77, 478
BstUI	CGCG	1 cut(s)	175
BstV1I	GCAGC	3 cut(s)	393, 524, 527
BstXI	CCANNNNNNTGG	1 cut(s)	85
Bsu15I	ATCGAT	1 cut(s)	44
BsuRI	GGCC	3 cut(s)	194, 252, 423
BsuTUI	ATCGAT	1 cut(s)	44
BtsCI	GGATG	1 cut(s)	535
BtsIMutI	CAGTG	1 cut(s)	230
Cac8I	GCNNGC	4 cut(s)	232, 260, 264, 363
CfoI	GCGC	2 cut(s)	148, 175
Cfr13I	GGNCC	3 cut(s)	180, 250, 270
ClaI	ATCGAT	1 cut(s)	44
CpoI	CGGWCCG	1 cut(s)	180
Csp6I	GTAC	2 cut(s)	73, 337
CspI	CGGWCCG	1 cut(s)	180
CviAII	CATG	4 cut(s)	13, 38, 247, 385
CviJI	RGCY	9 cut(s)	65, 132, 194, 234, 252, 331, 406, 423, 455
CviKI_1	RGCY	9 cut(s)	65, 132, 194, 234, 252, 331, 406, 423, 455
CviQI	GTAC	2 cut(s)	73, 337
DdeI	CTNAG	2 cut(s)	151, 215
DpnI	GATC	1 cut(s)	47
DpnII	GATC	1 cut(s)	45
EaeI	YGGCCR	1 cut(s)	192
Eam1104I	CTCTTC	2 cut(s)	158, 383
EarI	CTCTTC	2 cut(s)	158, 383
Ecl136II	GAGCTC	1 cut(s)	234
Eco24I	GRGCYC	1 cut(s)	236
Eco47I	GGWCC	2 cut(s)	180, 270
Eco53kI	GAGCTC	1 cut(s)	234
Eco57I	CTGAAG	1 cut(s)	438
Eco72I	CACGTG	1 cut(s)	358
EcoICRI	GAGCTC	1 cut(s)	234
EcoRI	GAATTC	1 cut(s)	426
EcoRII	CCWGG	2 cut(s)	77, 478
EcoT22I	ATGCAT	1 cut(s)	43
EcoT38I	GRGCYC	1 cut(s)	236
FaeI	CATG	4 cut(s)	16, 41, 250, 388
FaiI	YATR	4 cut(s)	14, 39, 248, 386
FaqI	GGGAC	2 cut(s)	190, 256
FatI	CATG	4 cut(s)	12, 37, 246, 384
Fnu4HI	GCNGC	5 cut(s)	407, 453, 514, 538, 541
FokI	GGATG	1 cut(s)	542
FriOI	GRGCYC	1 cut(s)	236
Fsp4HI	GCNGC	5 cut(s)	407, 453, 514, 538, 541
FspBI	CTAG	1 cut(s)	489
GlaI	GCGC	2 cut(s)	147, 174
GluI	GCNGC	5 cut(s)	407, 453, 514, 538, 541
GsaI	CCCAGC	1 cut(s)	141
GsuI	CTGGAG	2 cut(s)	61, 446
HaeIII	GGCC	3 cut(s)	194, 252, 423
HhaI	GCGC	2 cut(s)	148, 175
Hin1II	CATG	4 cut(s)	16, 41, 250, 388
Hin6I	GCGC	2 cut(s)	146, 173
HinP1I	GCGC	2 cut(s)	146, 173
HincII	GTYRAC	1 cut(s)	508
HindII	GTYRAC	1 cut(s)	508
HinfI	GANTC	4 cut(s)	4, 203, 284, 413
HpaI	GTTAAC	1 cut(s)	508
HphI	GGTGA	1 cut(s)	169
Hpy166II	GTNNAC	1 cut(s)	508
Hpy188I	TCNGA	3 cut(s)	154, 184, 418
Hpy188III	TCNNGA	2 cut(s)	200, 463
Hpy8I	GTNNAC	1 cut(s)	508
Hpy99I	CGWCG	2 cut(s)	180, 382
HpyAV	CCTTC	2 cut(s)	68, 413
HpyCH4III	ACNGT	3 cut(s)	53, 180, 440
HpyCH4IV	ACGT	1 cut(s)	357
HpyCH4V	TGCA	5 cut(s)	41, 355, 365, 409, 543
HpyF10VI	GCNNNNNNNGC	2 cut(s)	143, 522
HpyF3I	CTNAG	2 cut(s)	151, 215
HpySE526I	ACGT	1 cut(s)	357
Hsp92II	CATG	4 cut(s)	16, 41, 250, 388
HspAI	GCGC	2 cut(s)	146, 173
KspAI	GTTAAC	1 cut(s)	508
Kzo9I	GATC	1 cut(s)	45
Lsp1109I	GCAGC	3 cut(s)	393, 524, 527
LweI	GCATC	1 cut(s)	50
MaeI	CTAG	1 cut(s)	489
MaeII	ACGT	1 cut(s)	357
MaeIII	GTNAC	1 cut(s)	434
MalI	GATC	1 cut(s)	47
MboI	GATC	1 cut(s)	45
MboII	GAAGA	4 cut(s)	115, 118, 175, 400
MhlI	GDGCHC	1 cut(s)	236
MluCI	AATT	2 cut(s)	113, 426
MlyI	GAGTC	1 cut(s)	212
MmeI	TCCRAC	1 cut(s)	267
MnlI	CCTC	9 cut(s)	148, 153, 160, 218, 292, 384, 459, 470, 546
Mph1103I	ATGCAT	1 cut(s)	43
MseI	TTAA	3 cut(s)	312, 333, 507
MspCI	CTTAAG	2 cut(s)	311, 332
MspR9I	CCNGG	2 cut(s)	79, 480
MvaI	CCWGG	2 cut(s)	79, 480
MvnI	CGCG	1 cut(s)	175
MwoI	GCNNNNNNNGC	2 cut(s)	143, 522
NdeII	GATC	1 cut(s)	45
NlaIII	CATG	4 cut(s)	16, 41, 250, 388
NlaIV	GGNNCC	1 cut(s)	272
NmuCI	GTSAC	1 cut(s)	434
NsiI	ATGCAT	1 cut(s)	43
NspI	RCATGY	2 cut(s)	16, 41
NspV	TTCGAA	1 cut(s)	125
PciI	ACATGT	1 cut(s)	12
PcsI	WCGNNNNNNNCGW	1 cut(s)	553
PfeI	GAWTC	3 cut(s)	4, 284, 413
PkrI	GCNGC	5 cut(s)	408, 454, 515, 539, 542
PleI	GAGTC	1 cut(s)	211
PmaCI	CACGTG	1 cut(s)	358
PmlI	CACGTG	1 cut(s)	358
PpsI	GAGTC	1 cut(s)	211
Ppu21I	YACGTR	1 cut(s)	358
PscI	ACATGT	1 cut(s)	12
Psp124BI	GAGCTC	1 cut(s)	236
Psp6I	CCWGG	2 cut(s)	77, 478
PspCI	CACGTG	1 cut(s)	358
PspFI	CCCAGC	1 cut(s)	137
PspGI	CCWGG	2 cut(s)	77, 478
PspN4I	GGNNCC	1 cut(s)	272
PspPI	GGNCC	3 cut(s)	180, 250, 270
RsaI	GTAC	2 cut(s)	74, 338
RsaNI	GTAC	2 cut(s)	73, 337
Rsr2I	CGGWCCG	1 cut(s)	180
RsrII	CGGWCCG	1 cut(s)	180
SacI	GAGCTC	1 cut(s)	236
SaqAI	TTAA	3 cut(s)	312, 333, 507
SatI	GCNGC	5 cut(s)	407, 453, 514, 538, 541
Sau3AI	GATC	1 cut(s)	45
Sau96I	GGNCC	3 cut(s)	180, 250, 270
SchI	GAGTC	1 cut(s)	212
ScrFI	CCNGG	2 cut(s)	79, 480
SduI	GDGCHC	1 cut(s)	236
SetI	ASST	9 cut(s)	83, 159, 236, 282, 303, 333, 360, 408, 449
SfaNI	GCATC	1 cut(s)	50
SfuI	TTCGAA	1 cut(s)	125
SinI	GGWCC	2 cut(s)	180, 270
SmlI	CTYRAG	2 cut(s)	311, 332
SmoI	CTYRAG	2 cut(s)	311, 332
Sse9I	AATT	2 cut(s)	113, 426
SsiI	CCGC	2 cut(s)	452, 513
SspMI	CTAG	1 cut(s)	489
SstI	GAGCTC	1 cut(s)	236
StyD4I	CCNGG	2 cut(s)	77, 478
TaaI	ACNGT	3 cut(s)	53, 180, 440
TaiI	ACGT	1 cut(s)	360
TaqI	TCGA	2 cut(s)	44, 125
TaqII	GACCGA	1 cut(s)	258
TasI	AATT	2 cut(s)	113, 426
TatI	WGTACW	1 cut(s)	72
TauI	GCSGC	2 cut(s)	455, 516
TfiI	GAWTC	3 cut(s)	4, 284, 413
Tru1I	TTAA	3 cut(s)	312, 333, 507
Tru9I	TTAA	3 cut(s)	312, 333, 507
TscAI	CASTG	1 cut(s)	230
TseFI	GTSAC	1 cut(s)	434
TseI	GCWGC	3 cut(s)	406, 537, 540
Tsp45I	GTSAC	1 cut(s)	434
TspDTI	ATGAA	2 cut(s)	17, 401
TspRI	CASTG	1 cut(s)	230
Vha464I	CTTAAG	2 cut(s)	311, 332
VpaK11BI	GGWCC	2 cut(s)	180, 270
XapI	RAATTY	1 cut(s)	426
XceI	RCATGY	2 cut(s)	16, 41
XspI	CTAG	1 cut(s)	489
Zsp2I	ATGCAT	1 cut(s)	43

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.