Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr11

Orthogroup ID

OG0000120

Physical Location & Seq

Genomic Coordinates Reverse (-)

11231062 .. 11235740

Gene Structure 4679 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD11G1121800.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 546 bp

ATGAAGAATGATATGACCGCTGCGGTGGTGGCCAGGAACCTTCTCACTCCCAAAGATAACAGACTACTTTCCAAACGATCTGATGAGTTAGCTGTTAAGGATTCTCTGGCTCTCAGTGTTCAGTGTGCAGGTTCTGTGTCTAATATGGCCCAACGCCTATTTGCTCGAACCCGCCAAGTTGAATCATTGGCGGCTGAAGTGATGAGTCTCAAACAGGAGATTAGAGGGCTCAAGCATGAGAATAAACAGTTGCACCGTCTCGCACATGACTATGCTACAAACATGAAGAGGAAGTTGGACCAGATGAAGGAATCTGATGGTCAGGTTTTACTTGATCATCAGAGATTTTGTGGTTTGTTCCAAAGGCATTTATTGCCTTCGTCTTCTGGGGCTGTACCGCGTAATGAAGCTCCAAATGATCAACCTCTGATGCCTCCTCCTTCTAGGGTTCTGTCCAGTACTGAGGCTCCGAATGATCCCCCTCCGGTGCCTTCGCTTTCTGGGGCTCTACCGACTGCTGCGACTTCTCCTAAGCAACCTTTGTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004177 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005829 GO:0006508 GO:0006807 GO:0008150 GO:0008152 GO:0008233 GO:0008238 GO:0008239 GO:0016787 GO:0019538 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044238 GO:0044424 GO:0044444 GO:0044464 GO:0070011 GO:0071704 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

NUDIX Peptidase_M49

Protein Analysis

182

Amino Acids

19.86

Weight (kDa)

9.59

Isoelectric Point (pI)

55.53

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000120)

Species	Orthologous Gene IDs
malus_domestica	MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica	Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis	pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	119
AccB1I	GGYRCC	1 cut(s)	487
AccII	CGCG	1 cut(s)	400
AciI	CCGC	5 cut(s)	18, 23, 172, 191, 398
AclWI	GGATC	1 cut(s)	470
AcoI	YGGCCR	1 cut(s)	30
AcuI	CTGAAG	1 cut(s)	216
AfaI	GTAC	2 cut(s)	396, 460
AfiI	CCNNNNNNNGG	1 cut(s)	307
AgsI	TTSAA	1 cut(s)	182
AjnI	CCWGG	1 cut(s)	32
AjuI	GAANNNNNNNTTGG	2 cut(s)	278, 310
AluBI	AGCT	2 cut(s)	92, 410
AluI	AGCT	2 cut(s)	92, 410
Alw26I	GTCTC	2 cut(s)	212, 263
AlwI	GGATC	1 cut(s)	470
AlwNI	CAGNNNCTG	1 cut(s)	134
AoxI	GGCC	2 cut(s)	30, 147
ApeKI	GCWGC	2 cut(s)	20, 518
AspS9I	GGNCC	2 cut(s)	148, 298
AvaII	GGWCC	1 cut(s)	298
BalI	TGGCCA	1 cut(s)	32
BanI	GGYRCC	1 cut(s)	487
BanII	GRGCYC	2 cut(s)	231, 508
BbsI	GAAGAC	1 cut(s)	375
BbvI	GCAGC	2 cut(s)	7, 505
BccI	CCATC	1 cut(s)	311
BciT130I	CCWGG	1 cut(s)	34
BclI	TGATCA	2 cut(s)	334, 418
BcoDI	GTCTC	2 cut(s)	212, 263
BfaI	CTAG	1 cut(s)	444
BfuAI	ACCTGC	1 cut(s)	119
BisI	GCNGC	3 cut(s)	21, 192, 519
BlsI	GCNGC	3 cut(s)	22, 193, 520
BmcAI	AGTACT	1 cut(s)	460
Bme1390I	CCNGG	1 cut(s)	34
Bme18I	GGWCC	1 cut(s)	298
BmgT120I	GGNCC	2 cut(s)	148, 298
BmiI	GGNNCC	3 cut(s)	38, 468, 489
BmrFI	CCNGG	1 cut(s)	34
BmsI	GCATC	1 cut(s)	420
BpiI	GAAGAC	1 cut(s)	375
Bpu10I	CCTNAGC	1 cut(s)	531
BpuEI	CTTGAG	1 cut(s)	215
BsaWI	WCCGGW	1 cut(s)	484
BsaXI	ACNNNNNCTCC	2 cut(s)	451, 481
Bsc4I	CCNNNNNNNGG	1 cut(s)	307
Bse1I	ACTGG	1 cut(s)	456
BseBI	CCWGG	1 cut(s)	34
BseLI	CCNNNNNNNGG	1 cut(s)	307
BseMII	CTCAG	2 cut(s)	127, 453
BseNI	ACTGG	1 cut(s)	456
BseRI	GAGGAG	1 cut(s)	426
BseXI	GCAGC	2 cut(s)	7, 505
BsgI	GTGCAG	1 cut(s)	147
Bsh1236I	CGCG	1 cut(s)	400
BshFI	GGCC	2 cut(s)	32, 149
BshNI	GGYRCC	1 cut(s)	487
BsiSI	CCGG	1 cut(s)	485
BslI	CCNNNNNNNGG	1 cut(s)	307
BsmAI	GTCTC	2 cut(s)	212, 263
BsmBI	CGTCTC	1 cut(s)	263
BsnI	GGCC	2 cut(s)	32, 149
Bsp1286I	GDGCHC	2 cut(s)	231, 508
Bsp143I	GATC	4 cut(s)	77, 334, 418, 475
BspACI	CCGC	5 cut(s)	18, 23, 172, 191, 398
BspANI	GGCC	2 cut(s)	32, 149
BspCNI	CTCAG	2 cut(s)	126, 454
BspFNI	CGCG	1 cut(s)	400
BspLI	GGNNCC	3 cut(s)	38, 468, 489
BspMI	ACCTGC	1 cut(s)	119
BspPI	GGATC	1 cut(s)	470
BspT107I	GGYRCC	1 cut(s)	487
BsrI	ACTGG	1 cut(s)	456
BssMI	GATC	4 cut(s)	77, 334, 418, 475
Bst2UI	CCWGG	1 cut(s)	34
Bst4CI	ACNGT	2 cut(s)	249, 257
Bst6I	CTCTTC	1 cut(s)	281
BstAPI	GCANNNNNTGC	1 cut(s)	373
BstDEI	CTNAG	3 cut(s)	113, 462, 531
BstFNI	CGCG	1 cut(s)	400
BstKTI	GATC	4 cut(s)	80, 337, 421, 478
BstMAI	GTCTC	2 cut(s)	212, 263
BstMBI	GATC	4 cut(s)	77, 334, 418, 475
BstMWI	GCNNNNNNNGC	2 cut(s)	29, 373
BstNI	CCWGG	1 cut(s)	34
BstSCI	CCNGG	1 cut(s)	32
BstUI	CGCG	1 cut(s)	400
BstV1I	GCAGC	2 cut(s)	7, 505
BstV2I	GAAGAC	1 cut(s)	375
BsuRI	GGCC	2 cut(s)	32, 149
BtsIMutI	CAGTG	2 cut(s)	121, 128
BveI	ACCTGC	1 cut(s)	119
CaiI	CAGNNNCTG	1 cut(s)	134
Cfr13I	GGNCC	2 cut(s)	148, 298
Csp6I	GTAC	2 cut(s)	395, 459
CviAII	CATG	3 cut(s)	236, 266, 283
CviQI	GTAC	2 cut(s)	395, 459
DdeI	CTNAG	3 cut(s)	113, 462, 531
DpnI	GATC	4 cut(s)	79, 336, 420, 477
DpnII	GATC	4 cut(s)	77, 334, 418, 475
EaeI	YGGCCR	1 cut(s)	30
Eam1104I	CTCTTC	1 cut(s)	281
EarI	CTCTTC	1 cut(s)	281
Eco24I	GRGCYC	2 cut(s)	231, 508
Eco47I	GGWCC	1 cut(s)	298
Eco57I	CTGAAG	1 cut(s)	216
EcoRII	CCWGG	1 cut(s)	32
EcoT38I	GRGCYC	2 cut(s)	231, 508
Esp3I	CGTCTC	1 cut(s)	263
FaeI	CATG	3 cut(s)	239, 269, 286
FaiI	YATR	6 cut(s)	14, 146, 237, 267, 273, 284
FatI	CATG	3 cut(s)	235, 265, 282
FauI	CCCGC	1 cut(s)	179
FbaI	TGATCA	2 cut(s)	334, 418
Fnu4HI	GCNGC	3 cut(s)	21, 192, 519
FriOI	GRGCYC	2 cut(s)	231, 508
Fsp4HI	GCNGC	3 cut(s)	21, 192, 519
FspBI	CTAG	1 cut(s)	444
GluI	GCNGC	3 cut(s)	21, 192, 519
HaeIII	GGCC	2 cut(s)	32, 149
HapII	CCGG	1 cut(s)	485
Hin1II	CATG	3 cut(s)	239, 269, 286
HinfI	GANTC	4 cut(s)	101, 182, 205, 311
HpaII	CCGG	1 cut(s)	485
Hpy188I	TCNGA	5 cut(s)	82, 316, 342, 429, 471
HpyAV	CCTTC	5 cut(s)	50, 301, 387, 450, 501
HpyCH4III	ACNGT	2 cut(s)	249, 257
HpyCH4V	TGCA	2 cut(s)	128, 253
HpyF10VI	GCNNNNNNNGC	2 cut(s)	29, 373
HpyF3I	CTNAG	3 cut(s)	113, 462, 531
Hsp92II	CATG	3 cut(s)	239, 269, 286
Ksp22I	TGATCA	2 cut(s)	334, 418
Kzo9I	GATC	4 cut(s)	77, 334, 418, 475
LmnI	GCTCC	2 cut(s)	415, 472
Lsp1109I	GCAGC	2 cut(s)	7, 505
LweI	GCATC	1 cut(s)	420
MaeI	CTAG	1 cut(s)	444
MalI	GATC	4 cut(s)	79, 336, 420, 477
MboI	GATC	4 cut(s)	77, 334, 418, 475
MboII	GAAGA	3 cut(s)	16, 298, 375
MhlI	GDGCHC	2 cut(s)	231, 508
MlsI	TGGCCA	1 cut(s)	32
MluNI	TGGCCA	1 cut(s)	32
MlyI	GAGTC	1 cut(s)	214
MmeI	TCCRAC	1 cut(s)	276
MnlI	CCTC	7 cut(s)	218, 282, 435, 444, 447, 457, 492
Mox20I	TGGCCA	1 cut(s)	32
MscI	TGGCCA	1 cut(s)	32
MseI	TTAA	1 cut(s)	96
MslI	CAYNNNNRTG	1 cut(s)	270
Msp20I	TGGCCA	1 cut(s)	32
MspA1I	CMGCKG	1 cut(s)	20
MspI	CCGG	1 cut(s)	485
MspR9I	CCNGG	1 cut(s)	34
MvaI	CCWGG	1 cut(s)	34
MvnI	CGCG	1 cut(s)	400
MwoI	GCNNNNNNNGC	2 cut(s)	29, 373
NdeII	GATC	4 cut(s)	77, 334, 418, 475
NlaIII	CATG	3 cut(s)	239, 269, 286
NlaIV	GGNNCC	3 cut(s)	38, 468, 489
PfeI	GAWTC	3 cut(s)	101, 182, 311
PkrI	GCNGC	3 cut(s)	22, 193, 520
PleI	GAGTC	1 cut(s)	213
PpsI	GAGTC	1 cut(s)	213
Psp6I	CCWGG	1 cut(s)	32
PspGI	CCWGG	1 cut(s)	32
PspN4I	GGNNCC	3 cut(s)	38, 468, 489
PspPI	GGNCC	2 cut(s)	148, 298
PstNI	CAGNNNCTG	1 cut(s)	134
RsaI	GTAC	2 cut(s)	396, 460
RsaNI	GTAC	2 cut(s)	395, 459
RseI	CAYNNNNRTG	1 cut(s)	270
SaqAI	TTAA	1 cut(s)	96
SatI	GCNGC	3 cut(s)	21, 192, 519
Sau3AI	GATC	4 cut(s)	77, 334, 418, 475
Sau96I	GGNCC	2 cut(s)	148, 298
ScaI	AGTACT	1 cut(s)	460
SchI	GAGTC	1 cut(s)	214
ScrFI	CCNGG	1 cut(s)	34
SduI	GDGCHC	2 cut(s)	231, 508
SetI	ASST	7 cut(s)	42, 94, 133, 327, 412, 427, 541
SfaNI	GCATC	1 cut(s)	420
SinI	GGWCC	1 cut(s)	298
SmiMI	CAYNNNNRTG	1 cut(s)	270
SmlI	CTYRAG	1 cut(s)	230
SmoI	CTYRAG	1 cut(s)	230
SsiI	CCGC	5 cut(s)	18, 23, 172, 191, 398
SspMI	CTAG	1 cut(s)	444
StyD4I	CCNGG	1 cut(s)	32
TaaI	ACNGT	2 cut(s)	249, 257
TaqI	TCGA	1 cut(s)	166
TatI	WGTACW	1 cut(s)	458
TauI	GCSGC	1 cut(s)	194
TfiI	GAWTC	3 cut(s)	101, 182, 311
Tru1I	TTAA	1 cut(s)	96
Tru9I	TTAA	1 cut(s)	96
TscAI	CASTG	2 cut(s)	121, 128
TseI	GCWGC	2 cut(s)	20, 518
TspDTI	ATGAA	4 cut(s)	17, 299, 320, 420
TspRI	CASTG	2 cut(s)	121, 128
VpaK11BI	GGWCC	1 cut(s)	298
XspI	CTAG	1 cut(s)	444
ZrmI	AGTACT	1 cut(s)	460

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.