pycom12612g00020

Zinc finger MYM-type protein 1-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00012612
OG0000120
Physical Location & Seq
Forward (+)
7980 .. 8487
508 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom12612g00020.3

Sequence Viewer

Length: 363 bp
ATGCAGGCACCTACACTAGAATTCAAACCATTGCCGGTTCACTTCAAGTATCACCTTCCATTCAAGGACCAATTCCATGCCGTAGCTTTCACAAAGGTTGTTTGCTTGAGGCCCCACTACGTGGCATCGGAGCGGGAGGCATCGGAGCTAGAGCATTCCAGGCTTCAATACTTGGCCAAACGCTGGATGACCCAGGAAAAAGGTGCCTCTGGAGATAAGCCGAAAACCTCTGACGGTCGCTTTGAATCCGACCTTCAGACTCTTGCAGCTCATCAAGCTTCCTCTTCATGCCCGTCGAATAGTTGTTTGCAAGCACGTGCAAACTTCTATTCTCATACTTCAGCTGCTGGACCTCCTGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4371 Dimer_Tnp_hAT

Protein Analysis

121

Amino Acids

13.4

Weight (kDa)

8.84

Isoelectric Point (pI)

57.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 7, 203
AccB7I CCANNNNNTGG 2 cut(s) 121, 183
AccBSI CCGCTC 1 cut(s) 133
AciI CCGC 1 cut(s) 133
AcoI YGGCCR 1 cut(s) 174
AcsI RAATTY 1 cut(s) 20
AcuI CTGAAG 2 cut(s) 239, 324
AcvI CACGTG 1 cut(s) 317
AdeI CACNNNGTG 1 cut(s) 121
AfiI CCNNNNNNNGG 2 cut(s) 121, 183
AgsI TTSAA 5 cut(s) 25, 46, 64, 167, 245
AjnI CCWGG 2 cut(s) 158, 192
AluBI AGCT 5 cut(s) 86, 148, 269, 278, 344
AluI AGCT 5 cut(s) 86, 148, 269, 278, 344
AlwNI CAGNNNCTG 1 cut(s) 347
AoxI GGCC 2 cut(s) 110, 174
ApeKI GCWGC 2 cut(s) 266, 344
ApoI RAATTY 1 cut(s) 20
ArsI GACNNNNNNTTYG 2 cut(s) 224, 256
AspS9I GGNCC 3 cut(s) 67, 111, 350
AsuHPI GGTGA 1 cut(s) 44
AvaII GGWCC 2 cut(s) 67, 350
BalI TGGCCA 1 cut(s) 176
BanI GGYRCC 2 cut(s) 7, 203
BbrPI CACGTG 1 cut(s) 317
BbvI GCAGC 2 cut(s) 278, 331
BceAI ACGGC 1 cut(s) 65
BciT130I CCWGG 2 cut(s) 160, 194
BfaI CTAG 2 cut(s) 17, 149
BisI GCNGC 2 cut(s) 267, 345
BlsI GCNGC 2 cut(s) 268, 346
Bme1390I CCNGG 2 cut(s) 160, 194
Bme18I GGWCC 2 cut(s) 67, 350
BmgT120I GGNCC 3 cut(s) 67, 111, 350
BmiI GGNNCC 3 cut(s) 9, 113, 205
BmrFI CCNGG 2 cut(s) 160, 194
BmsI GCATC 2 cut(s) 134, 149
BpmI CTGGAG 1 cut(s) 231
BpuEI CTTGAG 1 cut(s) 127
BsaAI YACGTR 2 cut(s) 121, 317
BsaJI CCNNGG 1 cut(s) 192
Bsc4I CCNNNNNNNGG 2 cut(s) 121, 183
Bse118I RCCGGY 1 cut(s) 34
Bse3DI GCAATG 1 cut(s) 29
BseBI CCWGG 2 cut(s) 160, 194
BseDI CCNNGG 1 cut(s) 192
BseGI GGATG 1 cut(s) 192
BseLI CCNNNNNNNGG 2 cut(s) 121, 183
BseMI GCAATG 1 cut(s) 29
BseXI GCAGC 2 cut(s) 278, 331
Bsh1285I CGRYCG 1 cut(s) 238
BshFI GGCC 2 cut(s) 112, 176
BshNI GGYRCC 2 cut(s) 7, 203
BsiEI CGRYCG 1 cut(s) 238
BsiSI CCGG 1 cut(s) 35
BslI CCNNNNNNNGG 2 cut(s) 121, 183
BsmI GAATGC 1 cut(s) 154
BsnI GGCC 2 cut(s) 112, 176
BspACI CCGC 1 cut(s) 133
BspANI GGCC 2 cut(s) 112, 176
BspLI GGNNCC 3 cut(s) 9, 113, 205
BspT107I GGYRCC 2 cut(s) 7, 203
BsrBI CCGCTC 1 cut(s) 133
BsrDI GCAATG 1 cut(s) 29
BsrFI RCCGGY 1 cut(s) 34
BssAI RCCGGY 1 cut(s) 34
BssECI CCNNGG 1 cut(s) 192
Bst2UI CCWGG 2 cut(s) 160, 194
Bst4CI ACNGT 1 cut(s) 236
Bst6I CTCTTC 1 cut(s) 289
BstBAI YACGTR 2 cut(s) 121, 317
BstC8I GCNNGC 2 cut(s) 6, 312
BstF5I GGATG 1 cut(s) 192
BstMCI CGRYCG 1 cut(s) 238
BstMWI GCNNNNNNNGC 2 cut(s) 160, 275
BstNI CCWGG 2 cut(s) 160, 194
BstSCI CCNGG 2 cut(s) 158, 192
BstV1I GCAGC 2 cut(s) 278, 331
BsuRI GGCC 2 cut(s) 112, 176
BtsCI GGATG 1 cut(s) 192
Cac8I GCNNGC 2 cut(s) 6, 312
CaiI CAGNNNCTG 1 cut(s) 347
Cfr10I RCCGGY 1 cut(s) 34
Cfr13I GGNCC 3 cut(s) 67, 111, 350
CviAII CATG 2 cut(s) 77, 288
CviJI RGCY 9 cut(s) 86, 112, 148, 163, 176, 220, 269, 278, 344
CviKI_1 RGCY 9 cut(s) 86, 112, 148, 163, 176, 220, 269, 278, 344
DraIII CACNNNGTG 1 cut(s) 121
EaeI YGGCCR 1 cut(s) 174
Eam1104I CTCTTC 1 cut(s) 289
EarI CTCTTC 1 cut(s) 289
Eco47I GGWCC 2 cut(s) 67, 350
Eco57I CTGAAG 2 cut(s) 239, 324
Eco72I CACGTG 1 cut(s) 317
EcoO109I RGGNCCY 1 cut(s) 111
EcoRI GAATTC 1 cut(s) 20
EcoRII CCWGG 2 cut(s) 158, 192
FaeI CATG 2 cut(s) 80, 291
FaiI YATR 3 cut(s) 78, 289, 336
FatI CATG 2 cut(s) 76, 287
FauI CCCGC 1 cut(s) 126
Fnu4HI GCNGC 2 cut(s) 267, 345
FokI GGATG 1 cut(s) 199
Fsp4HI GCNGC 2 cut(s) 267, 345
FspBI CTAG 2 cut(s) 17, 149
GluI GCNGC 2 cut(s) 267, 345
GsuI CTGGAG 1 cut(s) 231
HaeIII GGCC 2 cut(s) 112, 176
HapII CCGG 1 cut(s) 35
Hin1II CATG 2 cut(s) 80, 291
HindIII AAGCTT 1 cut(s) 276
HinfI GANTC 2 cut(s) 245, 259
HpaII CCGG 1 cut(s) 35
HphI GGTGA 1 cut(s) 44
Hpy166II GTNNAC 1 cut(s) 40
Hpy188I TCNGA 5 cut(s) 130, 145, 232, 250, 258
Hpy188III TCNNGA 1 cut(s) 210
Hpy8I GTNNAC 1 cut(s) 40
Hpy99I CGWCG 1 cut(s) 298
HpyAV CCTTC 2 cut(s) 65, 263
HpyCH4III ACNGT 1 cut(s) 236
HpyCH4IV ACGT 2 cut(s) 120, 316
HpyCH4V TGCA 4 cut(s) 4, 266, 310, 320
HpyF10VI GCNNNNNNNGC 2 cut(s) 160, 275
HpySE526I ACGT 2 cut(s) 120, 316
Hsp92II CATG 2 cut(s) 80, 291
LmnI GCTCC 2 cut(s) 130, 145
LpnPI CCDG 8 cut(s) 48, 145, 169, 172, 179, 195, 206, 333
Lsp1109I GCAGC 2 cut(s) 278, 331
LweI GCATC 2 cut(s) 134, 149
MaeI CTAG 2 cut(s) 17, 149
MaeII ACGT 2 cut(s) 120, 316
MbiI CCGCTC 1 cut(s) 133
MboII GAAGA 1 cut(s) 276
MlsI TGGCCA 1 cut(s) 176
MluCI AATT 2 cut(s) 20, 71
MluNI TGGCCA 1 cut(s) 176
MlyI GAGTC 1 cut(s) 253
MmeI TCCRAC 1 cut(s) 273
MnlI CCTC 6 cut(s) 102, 130, 217, 238, 292, 363
Mox20I TGGCCA 1 cut(s) 176
MscI TGGCCA 1 cut(s) 176
Msp20I TGGCCA 1 cut(s) 176
MspA1I CMGCKG 1 cut(s) 344
MspI CCGG 1 cut(s) 35
MspR9I CCNGG 2 cut(s) 160, 194
Mva1269I GAATGC 1 cut(s) 154
MvaI CCWGG 2 cut(s) 160, 194
MwoI GCNNNNNNNGC 2 cut(s) 160, 275
NlaIII CATG 2 cut(s) 80, 291
NlaIV GGNNCC 3 cut(s) 9, 113, 205
PctI GAATGC 1 cut(s) 154
PfeI GAWTC 1 cut(s) 245
PflMI CCANNNNNTGG 2 cut(s) 121, 183
PkrI GCNGC 2 cut(s) 268, 346
PleI GAGTC 1 cut(s) 253
PmaCI CACGTG 1 cut(s) 317
PmlI CACGTG 1 cut(s) 317
PpsI GAGTC 1 cut(s) 253
Ppu21I YACGTR 2 cut(s) 121, 317
Psp6I CCWGG 2 cut(s) 158, 192
PspCI CACGTG 1 cut(s) 317
PspGI CCWGG 2 cut(s) 158, 192
PspN4I GGNNCC 3 cut(s) 9, 113, 205
PspPI GGNCC 3 cut(s) 67, 111, 350
PstNI CAGNNNCTG 1 cut(s) 347
PvuII CAGCTG 1 cut(s) 344
SatI GCNGC 2 cut(s) 267, 345
Sau96I GGNCC 3 cut(s) 67, 111, 350
SchI GAGTC 1 cut(s) 253
ScrFI CCNGG 2 cut(s) 160, 194
SfaNI GCATC 2 cut(s) 134, 149
SinI GGWCC 2 cut(s) 67, 350
SmlI CTYRAG 1 cut(s) 106
SmoI CTYRAG 1 cut(s) 106
Sse9I AATT 2 cut(s) 20, 71
SsiI CCGC 1 cut(s) 133
SspMI CTAG 2 cut(s) 17, 149
StyD4I CCNGG 2 cut(s) 158, 192
TaaI ACNGT 1 cut(s) 236
TaiI ACGT 2 cut(s) 123, 319
TaqI TCGA 1 cut(s) 296
TasI AATT 2 cut(s) 20, 71
TfiI GAWTC 1 cut(s) 245
TseI GCWGC 2 cut(s) 266, 344
TspDTI ATGAA 1 cut(s) 276
Van91I CCANNNNNTGG 2 cut(s) 121, 183
VpaK11BI GGWCC 2 cut(s) 67, 350
XapI RAATTY 1 cut(s) 20
XspI CTAG 2 cut(s) 17, 149
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.