Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

tig00012575

Orthogroup ID

OG0000120

Physical Location & Seq

Genomic Coordinates Forward (+)

70502 .. 73503

Gene Structure 3002 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom12575g00030.3

Sequence Viewer

CDS Protein Promoter (2k)

Length: 873 bp

ATGATGTTGAACGCGTTTTCTGAAAAGCCGAGAACGCGTCGCCTAAATTACACCGGAAATTCCGGTTTTTTTGAATTGGTGGACGCGTCGCCTTGGCTTCTTATAGAGGCAAACTCATCGAACCTTAGCTTGGAATTGAGCCTTAGCAGTGATACGGGCGCGCCGCGTCAAGGTAACGTATGGCGCCCTTCTTTCTTATCTTCTAACGGTCTTCTTACAGGTGAAGACTTCGTGATGCAGGACGCCATAACAGCTACAATAGTAGCTAGGAACCTCCTCACTCCAAAAGATAGTAGGCTGCTGTCAGGACGGTCCGATGAGTTGGCCGTTCAAGAGTCCCTCGCACTTAGTGTTCAGTGTGCGAGTTCTGTGTCCAACATGGGCCAACGCCTGCTTGCCCGTTCCCGTCAGGTGGAATCATTGATGGCAGAGGTGGAAAGTCTTAAGCAAGAGATCCAGCAGCTTAAGTACGAGAATAGAAGTTTGCACGTGCTTGCCAACAACTATTCGACGGGCATGAAGAGGAAGCTTGATGAGCTGCAAGAGTCTGAAGGTCGGATTCACAGTGACCGTCAAAGGTTTTCGTCTTTCCTCCAGAGGCACCTTTTTCCTGGCTCATCCAGCGCTTGGCCAAGTATTGAGGCCTGGAATGCTTTAGCTCCGATGCCTCCCGCTCCGATGCCTTCCGCTCCGATGCCTTCCGCTTCGATGCCTTCCGCTCCGATGCCTCGTAGTGGGGCTTCACGTAAACAACCTTTTCCCCTACATGATTGCATAATAGAGATACAAGCAAGAATCATTACGCTCTATGAAAATTATAAGCCAAGAATTCGTTTAACGCGATTGTTTATAAGCAACCTCCACTACTTGTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004177 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005829 GO:0006508 GO:0006807 GO:0008150 GO:0008152 GO:0008233 GO:0008238 GO:0008239 GO:0016787 GO:0019538 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044238 GO:0044424 GO:0044444 GO:0044464 GO:0070011 GO:0071704 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

NUDIX Peptidase_M49

Protein Analysis

291

Amino Acids

32.44

Weight (kDa)

9.17

Isoelectric Point (pI)

60.59

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000120)

Species	Orthologous Gene IDs
malus_domestica	MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica	Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis	pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	2 cut(s)	819, 851
AccB1I	GGYRCC	2 cut(s)	183, 600
AccB7I	CCANNNNNTGG	1 cut(s)	627
AccBSI	CCGCTC	3 cut(s)	674, 689, 719
AccII	CGCG	6 cut(s)	14, 37, 86, 161, 166, 841
AciI	CCGC	5 cut(s)	164, 672, 687, 702, 717
AclWI	GGATC	1 cut(s)	448
AcoI	YGGCCR	2 cut(s)	324, 629
AcsI	RAATTY	2 cut(s)	58, 828
AcuI	CTGAAG	1 cut(s)	570
AcvI	CACGTG	1 cut(s)	490
AcyI	GRCGYC	2 cut(s)	184, 243
AdeI	CACNNNGTG	1 cut(s)	350
AfaI	GTAC	1 cut(s)	470
AfeI	AGCGCT	1 cut(s)	625
AfiI	CCNNNNNNNGG	5 cut(s)	130, 170, 412, 627, 734
AflII	CTTAAG	2 cut(s)	443, 464
AflIII	ACRYGT	3 cut(s)	12, 35, 84
AgsI	TTSAA	3 cut(s)	10, 74, 332
AjnI	CCWGG	2 cut(s)	610, 644
AjuI	GAANNNNNNNTTGG	2 cut(s)	113, 145
AluBI	AGCT	7 cut(s)	129, 254, 266, 463, 529, 538, 659
AluI	AGCT	7 cut(s)	129, 254, 266, 463, 529, 538, 659
AlwI	GGATC	1 cut(s)	448
Aor51HI	AGCGCT	1 cut(s)	625
AoxI	GGCC	4 cut(s)	324, 382, 629, 642
ApeKI	GCWGC	3 cut(s)	298, 460, 538
ApoI	RAATTY	2 cut(s)	58, 828
AscI	GGCGCGCC	1 cut(s)	159
AspLEI	GCGC	4 cut(s)	161, 163, 186, 626
AspS9I	GGNCC	2 cut(s)	312, 382
AsuHPI	GGTGA	1 cut(s)	233
AvaII	GGWCC	1 cut(s)	312
BalI	TGGCCA	1 cut(s)	631
BanI	GGYRCC	2 cut(s)	183, 600
BarI	GAAGNNNNNNTAC	2 cut(s)	724, 756
BbrPI	CACGTG	1 cut(s)	490
BbsI	GAAGAC	2 cut(s)	203, 231
BbvI	GCAGC	3 cut(s)	285, 472, 525
BccI	CCATC	1 cut(s)	418
BceAI	ACGGC	1 cut(s)	311
BcgI	CGANNNNNNTGC	2 cut(s)	99, 133
BciT130I	CCWGG	2 cut(s)	612, 646
BfaI	CTAG	1 cut(s)	267
BfoI	RGCGCY	2 cut(s)	187, 627
BfrI	CTTAAG	2 cut(s)	443, 464
BisI	GCNGC	4 cut(s)	164, 299, 461, 539
BlsI	GCNGC	4 cut(s)	165, 300, 462, 540
Bme1390I	CCNGG	2 cut(s)	612, 646
Bme18I	GGWCC	1 cut(s)	312
BmgT120I	GGNCC	2 cut(s)	312, 382
BmiI	GGNNCC	3 cut(s)	185, 272, 602
BmrFI	CCNGG	2 cut(s)	612, 646
BmsI	GCATC	6 cut(s)	225, 654, 669, 684, 699, 714
BpiI	GAAGAC	2 cut(s)	203, 231
BplI	GAGNNNNNCTC	2 cut(s)	98, 130
BpmI	CTGGAG	1 cut(s)	578
Bpu10I	CCTNAGC	2 cut(s)	125, 143
BsaAI	YACGTR	2 cut(s)	490, 746
BsaHI	GRCGYC	2 cut(s)	184, 243
BsaJI	CCNNGG	1 cut(s)	92
BsaWI	WCCGGW	2 cut(s)	53, 62
Bsc4I	CCNNNNNNNGG	5 cut(s)	130, 170, 412, 627, 734
BseBI	CCWGG	2 cut(s)	612, 646
BseDI	CCNNGG	1 cut(s)	92
BseGI	GGATG	1 cut(s)	617
BseLI	CCNNNNNNNGG	5 cut(s)	130, 170, 412, 627, 734
BsePI	GCGCGC	1 cut(s)	159
BseRI	GAGGAG	1 cut(s)	266
BseXI	GCAGC	3 cut(s)	285, 472, 525
Bsh1236I	CGCG	6 cut(s)	14, 37, 86, 161, 166, 841
BshFI	GGCC	4 cut(s)	326, 384, 631, 644
BshNI	GGYRCC	2 cut(s)	183, 600
BsiSI	CCGG	2 cut(s)	54, 63
BslFI	GGGAC	1 cut(s)	322
BslI	CCNNNNNNNGG	5 cut(s)	130, 170, 412, 627, 734
BsmFI	GGGAC	1 cut(s)	322
BsmI	GAATGC	1 cut(s)	655
BsnI	GGCC	4 cut(s)	326, 384, 631, 644
Bsp143I	GATC	1 cut(s)	453
BspACI	CCGC	5 cut(s)	164, 672, 687, 702, 717
BspANI	GGCC	4 cut(s)	326, 384, 631, 644
BspFNI	CGCG	6 cut(s)	14, 37, 86, 161, 166, 841
BspLI	GGNNCC	3 cut(s)	185, 272, 602
BspPI	GGATC	1 cut(s)	448
BspT107I	GGYRCC	2 cut(s)	183, 600
BspTI	CTTAAG	2 cut(s)	443, 464
BsrBI	CCGCTC	3 cut(s)	674, 689, 719
BssECI	CCNNGG	1 cut(s)	92
BssHII	GCGCGC	1 cut(s)	159
BssMI	GATC	1 cut(s)	453
BssNI	GRCGYC	2 cut(s)	184, 243
BssT1I	CCWWGG	1 cut(s)	92
Bst2UI	CCWGG	2 cut(s)	612, 646
Bst4CI	ACNGT	4 cut(s)	209, 312, 566, 572
Bst6I	CTCTTC	1 cut(s)	515
BstACI	GRCGYC	2 cut(s)	184, 243
BstAFI	CTTAAG	2 cut(s)	443, 464
BstBAI	YACGTR	2 cut(s)	490, 746
BstC8I	GCNNGC	4 cut(s)	161, 392, 396, 495
BstDEI	CTNAG	3 cut(s)	125, 143, 347
BstF5I	GGATG	1 cut(s)	617
BstFNI	CGCG	6 cut(s)	14, 37, 86, 161, 166, 841
BstH2I	RGCGCY	2 cut(s)	187, 627
BstHHI	GCGC	4 cut(s)	161, 163, 186, 626
BstKTI	GATC	1 cut(s)	456
BstMBI	GATC	1 cut(s)	453
BstMWI	GCNNNNNNNGC	5 cut(s)	34, 251, 535, 621, 650
BstNI	CCWGG	2 cut(s)	612, 646
BstSCI	CCNGG	2 cut(s)	610, 644
BstUI	CGCG	6 cut(s)	14, 37, 86, 161, 166, 841
BstV1I	GCAGC	3 cut(s)	285, 472, 525
BstV2I	GAAGAC	2 cut(s)	203, 231
BstX2I	RGATCY	1 cut(s)	453
BstYI	RGATCY	1 cut(s)	453
BsuRI	GGCC	4 cut(s)	326, 384, 631, 644
BtsCI	GGATG	1 cut(s)	617
BtsI	GCAGTG	1 cut(s)	154
BtsIMutI	CAGTG	3 cut(s)	154, 362, 571
Cac8I	GCNNGC	4 cut(s)	161, 392, 396, 495
CfoI	GCGC	4 cut(s)	161, 163, 186, 626
Cfr13I	GGNCC	2 cut(s)	312, 382
CpoI	CGGWCCG	1 cut(s)	312
CseI	GACGC	5 cut(s)	26, 75, 92, 155, 251
Csp6I	GTAC	1 cut(s)	469
CspI	CGGWCCG	1 cut(s)	312
CviAII	CATG	3 cut(s)	379, 517, 767
CviQI	GTAC	1 cut(s)	469
DdeI	CTNAG	3 cut(s)	125, 143, 347
DinI	GGCGCC	1 cut(s)	185
DpnI	GATC	1 cut(s)	455
DpnII	GATC	1 cut(s)	453
DraIII	CACNNNGTG	1 cut(s)	350
EaeI	YGGCCR	2 cut(s)	324, 629
Eam1104I	CTCTTC	1 cut(s)	515
EarI	CTCTTC	1 cut(s)	515
Eco130I	CCWWGG	1 cut(s)	92
Eco147I	AGGCCT	1 cut(s)	644
Eco47I	GGWCC	1 cut(s)	312
Eco47III	AGCGCT	1 cut(s)	625
Eco57I	CTGAAG	1 cut(s)	570
Eco72I	CACGTG	1 cut(s)	490
EcoRI	GAATTC	1 cut(s)	828
EcoRII	CCWGG	2 cut(s)	610, 644
EcoT14I	CCWWGG	1 cut(s)	92
EgeI	GGCGCC	1 cut(s)	185
EheI	GGCGCC	1 cut(s)	185
ErhI	CCWWGG	1 cut(s)	92
FaeI	CATG	3 cut(s)	382, 520, 770
FaqI	GGGAC	1 cut(s)	322
FatI	CATG	3 cut(s)	378, 516, 766
FauI	CCCGC	1 cut(s)	679
Fnu4HI	GCNGC	4 cut(s)	164, 299, 461, 539
FokI	GGATG	1 cut(s)	604
Fsp4HI	GCNGC	4 cut(s)	164, 299, 461, 539
FspBI	CTAG	1 cut(s)	267
GlaI	GCGC	4 cut(s)	160, 162, 185, 625
GluI	GCNGC	4 cut(s)	164, 299, 461, 539
GsuI	CTGGAG	1 cut(s)	578
HaeII	RGCGCY	2 cut(s)	187, 627
HaeIII	GGCC	4 cut(s)	326, 384, 631, 644
HapII	CCGG	2 cut(s)	54, 63
HgaI	GACGC	5 cut(s)	26, 75, 92, 155, 251
HhaI	GCGC	4 cut(s)	161, 163, 186, 626
Hin1I	GRCGYC	2 cut(s)	184, 243
Hin1II	CATG	3 cut(s)	382, 520, 770
Hin6I	GCGC	4 cut(s)	159, 161, 184, 624
HinP1I	GCGC	4 cut(s)	159, 161, 184, 624
HindIII	AAGCTT	1 cut(s)	527
HinfI	GANTC	5 cut(s)	335, 416, 545, 559, 795
HpaII	CCGG	2 cut(s)	54, 63
HphI	GGTGA	1 cut(s)	233
Hpy166II	GTNNAC	2 cut(s)	82, 749
Hpy188I	TCNGA	8 cut(s)	22, 316, 550, 558, 663, 678, 693, 723
Hpy188III	TCNNGA	4 cut(s)	232, 306, 332, 595
Hpy8I	GTNNAC	2 cut(s)	82, 749
Hpy99I	CGWCG	3 cut(s)	42, 91, 514
HpyAV	CCTTC	5 cut(s)	198, 545, 693, 708, 723
HpyCH4III	ACNGT	4 cut(s)	209, 312, 566, 572
HpyCH4IV	ACGT	3 cut(s)	177, 489, 745
HpyCH4V	TGCA	4 cut(s)	238, 487, 541, 774
HpyF10VI	GCNNNNNNNGC	5 cut(s)	34, 251, 535, 621, 650
HpyF3I	CTNAG	3 cut(s)	125, 143, 347
HpySE526I	ACGT	3 cut(s)	177, 489, 745
Hsp92I	GRCGYC	2 cut(s)	184, 243
Hsp92II	CATG	3 cut(s)	382, 520, 770
HspAI	GCGC	4 cut(s)	159, 161, 184, 624
KasI	GGCGCC	1 cut(s)	183
Kzo9I	GATC	1 cut(s)	453
LmnI	GCTCC	4 cut(s)	664, 679, 694, 724
Lsp1109I	GCAGC	3 cut(s)	285, 472, 525
LweI	GCATC	6 cut(s)	225, 654, 669, 684, 699, 714
MaeI	CTAG	1 cut(s)	267
MaeII	ACGT	3 cut(s)	177, 489, 745
MaeIII	GTNAC	2 cut(s)	173, 566
MalI	GATC	1 cut(s)	455
MbiI	CCGCTC	3 cut(s)	674, 689, 719
MboI	GATC	1 cut(s)	453
MboII	GAAGA	4 cut(s)	192, 203, 236, 532
MflI	RGATCY	1 cut(s)	453
MlsI	TGGCCA	1 cut(s)	631
MluCI	AATT	6 cut(s)	46, 58, 74, 134, 814, 828
MluI	ACGCGT	3 cut(s)	12, 35, 84
MluNI	TGGCCA	1 cut(s)	631
Mly113I	GGCGCC	1 cut(s)	184
MlyI	GAGTC	2 cut(s)	344, 554
MmeI	TCCRAC	2 cut(s)	399, 536
Mox20I	TGGCCA	1 cut(s)	631
MscI	TGGCCA	1 cut(s)	631
MseI	TTAA	3 cut(s)	444, 465, 836
Msp20I	TGGCCA	1 cut(s)	631
MspCI	CTTAAG	2 cut(s)	443, 464
MspI	CCGG	2 cut(s)	54, 63
MspR9I	CCNGG	2 cut(s)	612, 646
Mva1269I	GAATGC	1 cut(s)	655
MvaI	CCWGG	2 cut(s)	612, 646
MvnI	CGCG	6 cut(s)	14, 37, 86, 161, 166, 841
MwoI	GCNNNNNNNGC	5 cut(s)	34, 251, 535, 621, 650
NarI	GGCGCC	1 cut(s)	184
NdeII	GATC	1 cut(s)	453
NlaIII	CATG	3 cut(s)	382, 520, 770
NlaIV	GGNNCC	3 cut(s)	185, 272, 602
NmeAIII	GCCGAG	1 cut(s)	54
NmuCI	GTSAC	1 cut(s)	566
PalAI	GGCGCGCC	1 cut(s)	159
PauI	GCGCGC	1 cut(s)	159
PceI	AGGCCT	1 cut(s)	644
PcsI	WCGNNNNNNNCGW	1 cut(s)	838
PctI	GAATGC	1 cut(s)	655
PfeI	GAWTC	3 cut(s)	416, 559, 795
PflMI	CCANNNNNTGG	1 cut(s)	627
PkrI	GCNGC	4 cut(s)	165, 300, 462, 540
PleI	GAGTC	2 cut(s)	343, 553
PluTI	GGCGCC	1 cut(s)	187
PmaCI	CACGTG	1 cut(s)	490
PmlI	CACGTG	1 cut(s)	490
PpsI	GAGTC	2 cut(s)	343, 553
Ppu21I	YACGTR	2 cut(s)	490, 746
PsiI	TTATAA	2 cut(s)	819, 851
Psp6I	CCWGG	2 cut(s)	610, 644
PspCI	CACGTG	1 cut(s)	490
PspGI	CCWGG	2 cut(s)	610, 644
PspN4I	GGNNCC	3 cut(s)	185, 272, 602
PspPI	GGNCC	2 cut(s)	312, 382
PsuI	RGATCY	1 cut(s)	453
PteI	GCGCGC	1 cut(s)	159
RsaI	GTAC	1 cut(s)	470
RsaNI	GTAC	1 cut(s)	469
Rsr2I	CGGWCCG	1 cut(s)	312
RsrII	CGGWCCG	1 cut(s)	312
SaqAI	TTAA	3 cut(s)	444, 465, 836
SatI	GCNGC	4 cut(s)	164, 299, 461, 539
Sau3AI	GATC	1 cut(s)	453
Sau96I	GGNCC	2 cut(s)	312, 382
SchI	GAGTC	2 cut(s)	344, 554
ScrFI	CCNGG	2 cut(s)	612, 646
SfaNI	GCATC	6 cut(s)	225, 654, 669, 684, 699, 714
SfoI	GGCGCC	1 cut(s)	185
SgsI	GGCGCGCC	1 cut(s)	159
SinI	GGWCC	1 cut(s)	312
SmlI	CTYRAG	2 cut(s)	443, 464
SmoI	CTYRAG	2 cut(s)	443, 464
Sse9I	AATT	6 cut(s)	46, 58, 74, 134, 814, 828
SseBI	AGGCCT	1 cut(s)	644
SsiI	CCGC	5 cut(s)	164, 672, 687, 702, 717
SspDI	GGCGCC	1 cut(s)	183
SspMI	CTAG	1 cut(s)	267
StuI	AGGCCT	1 cut(s)	644
StyD4I	CCNGG	2 cut(s)	610, 644
StyI	CCWWGG	1 cut(s)	92
TaaI	ACNGT	4 cut(s)	209, 312, 566, 572
TaiI	ACGT	3 cut(s)	180, 492, 748
TaqI	TCGA	3 cut(s)	119, 509, 707
TasI	AATT	6 cut(s)	46, 58, 74, 134, 814, 828
TauI	GCSGC	1 cut(s)	166
TfiI	GAWTC	3 cut(s)	416, 559, 795
Tru1I	TTAA	3 cut(s)	444, 465, 836
Tru9I	TTAA	3 cut(s)	444, 465, 836
TscAI	CASTG	3 cut(s)	154, 362, 571
TseFI	GTSAC	1 cut(s)	566
TseI	GCWGC	3 cut(s)	298, 460, 538
Tsp45I	GTSAC	1 cut(s)	566
TspDTI	ATGAA	2 cut(s)	533, 825
TspRI	CASTG	3 cut(s)	154, 362, 571
Van91I	CCANNNNNTGG	1 cut(s)	627
Vha464I	CTTAAG	2 cut(s)	443, 464
VpaK11BI	GGWCC	1 cut(s)	312
XapI	RAATTY	2 cut(s)	58, 828
XspI	CTAG	1 cut(s)	267

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.