Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

tig00001880

Orthogroup ID

OG0000120

Physical Location & Seq

Genomic Coordinates Forward (+)

26650 .. 33663

Gene Structure 7014 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom1880g00030.2

Sequence Viewer

CDS Protein Promoter (2k)

Length: 780 bp

ATGAGGAGTGGTGTGGATGTTGTAGGTGAAGTGGATGTAGCGGCAAACTCATCGAACCTTAGCTTAGATTTGAGTCTCAGCAGCGATCCGGTTGCGCCCCGTCAAGGTAATGTATGGCGCCCTTCTTTTTTATCTTCTAACGGTCCTCTTTCAGGTGAAGACTCTGTGATGCAGGACGCCACAACAGCTACAATAGTAGCTAAAAACCTCCTCACTCCAAAAGATAGTAGGCTGCTGTCAGGACGGTCCGATGAGTTGGCCGTTCAAGAGTCCCTCGCACTTAGTGTTCAGTGTGCGAGTTCTGTGTCCAACATGGGCCAACGCCTGCTTGCTCGGTCCCGCCAAGTGGAATCGTTGATGGCAGAGGTGGAAAGACTTAAGCAAGAGATCCAGCAGCTTAAGTACGAGAATAGAAGTTTGCATGTGCTTGCAAATAACTATTCGTCGGGGATGAAGAGGAAGCTTGATGAGCTGCAAGAATCTGAGGGTCGAATTCACAGTGACCGTCAAAGGCTTGCGTCTTATCTCCAGAGGCACCTTTTTCCTGGGTCATCCAGCGCTTGGCCAAGTATTGAGGCCTGGAATGCTCTAGCTCCGATGCCTCCCGCTCCGATGCCTCCCGCTTCTATGCCTCCCGCTTCTATGCCTTCCGCTTCTGCGCCTCGTAGTGGGGCTTCACGCAAACAACCTTTGAGTGGTGTTTGGATTATAAGGGAATGGATGGGAAGCTCACGGCTAGGGAAGGGAGAATGTGTTTGTAATGTGTTGTGTATGAAATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004177 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005829 GO:0006508 GO:0006807 GO:0008150 GO:0008152 GO:0008233 GO:0008238 GO:0008239 GO:0016787 GO:0019538 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044238 GO:0044424 GO:0044444 GO:0044464 GO:0070011 GO:0071704 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

NUDIX Peptidase_M49

Protein Analysis

260

Amino Acids

28.09

Weight (kDa)

8.73

Isoelectric Point (pI)

62.69

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000120)

Species	Orthologous Gene IDs
malus_domestica	MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica	Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis	pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	710
AccB1I	GGYRCC	2 cut(s)	117, 534
AccB7I	CCANNNNNTGG	1 cut(s)	561
AccBSI	CCGCTC	1 cut(s)	608
AciI	CCGC	6 cut(s)	41, 340, 606, 621, 636, 651
AclWI	GGATC	2 cut(s)	80, 382
AcoI	YGGCCR	2 cut(s)	258, 563
AcsI	RAATTY	1 cut(s)	492
AcyI	GRCGYC	2 cut(s)	118, 177
AdeI	CACNNNGTG	1 cut(s)	284
AfaI	GTAC	1 cut(s)	404
AfeI	AGCGCT	1 cut(s)	559
AfiI	CCNNNNNNNGG	6 cut(s)	104, 152, 346, 561, 668, 695
AflII	CTTAAG	2 cut(s)	377, 398
AgsI	TTSAA	1 cut(s)	266
AjnI	CCWGG	2 cut(s)	544, 578
AluBI	AGCT	8 cut(s)	63, 188, 200, 397, 463, 472, 593, 729
AluI	AGCT	8 cut(s)	63, 188, 200, 397, 463, 472, 593, 729
Alw26I	GTCTC	1 cut(s)	80
AlwI	GGATC	2 cut(s)	80, 382
Aor51HI	AGCGCT	1 cut(s)	559
AoxI	GGCC	4 cut(s)	258, 316, 563, 576
ApeKI	GCWGC	4 cut(s)	81, 232, 394, 472
ApoI	RAATTY	1 cut(s)	492
AspLEI	GCGC	4 cut(s)	97, 120, 560, 661
AspS9I	GGNCC	4 cut(s)	143, 246, 316, 336
AsuHPI	GGTGA	2 cut(s)	38, 167
AvaII	GGWCC	3 cut(s)	143, 246, 336
BalI	TGGCCA	1 cut(s)	565
BanI	GGYRCC	2 cut(s)	117, 534
BarI	GAAGNNNNNNTAC	2 cut(s)	658, 690
BbsI	GAAGAC	1 cut(s)	165
BbvI	GCAGC	4 cut(s)	93, 219, 406, 459
BccI	CCATC	2 cut(s)	352, 715
BceAI	ACGGC	2 cut(s)	245, 749
BcgI	CGANNNNNNTGC	4 cut(s)	33, 67, 74, 108
BciT130I	CCWGG	2 cut(s)	546, 580
BcoDI	GTCTC	1 cut(s)	80
BfaI	CTAG	2 cut(s)	590, 737
BfoI	RGCGCY	2 cut(s)	121, 561
BfrI	CTTAAG	2 cut(s)	377, 398
BisI	GCNGC	5 cut(s)	42, 82, 233, 395, 473
BlsI	GCNGC	5 cut(s)	43, 83, 234, 396, 474
Bme1390I	CCNGG	2 cut(s)	546, 580
Bme18I	GGWCC	3 cut(s)	143, 246, 336
BmgT120I	GGNCC	4 cut(s)	143, 246, 316, 336
BmiI	GGNNCC	3 cut(s)	119, 338, 536
BmrFI	CCNGG	2 cut(s)	546, 580
BmsI	GCATC	3 cut(s)	159, 588, 603
BpiI	GAAGAC	1 cut(s)	165
BpmI	CTGGAG	1 cut(s)	512
Bpu10I	CCTNAGC	1 cut(s)	59
BsaHI	GRCGYC	2 cut(s)	118, 177
BsaJI	CCNNGG	1 cut(s)	545
BsaWI	WCCGGW	1 cut(s)	88
BsaXI	ACNNNNNCTCC	2 cut(s)	738, 768
Bsc4I	CCNNNNNNNGG	6 cut(s)	104, 152, 346, 561, 668, 695
BseBI	CCWGG	2 cut(s)	546, 580
BseDI	CCNNGG	1 cut(s)	545
BseGI	GGATG	5 cut(s)	22, 40, 456, 551, 726
BseLI	CCNNNNNNNGG	6 cut(s)	104, 152, 346, 561, 668, 695
BseMII	CTCAG	2 cut(s)	91, 474
BseRI	GAGGAG	2 cut(s)	19, 200
BseXI	GCAGC	4 cut(s)	93, 219, 406, 459
BshFI	GGCC	4 cut(s)	260, 318, 565, 578
BshNI	GGYRCC	2 cut(s)	117, 534
BsiSI	CCGG	1 cut(s)	89
BslFI	GGGAC	2 cut(s)	256, 322
BslI	CCNNNNNNNGG	6 cut(s)	104, 152, 346, 561, 668, 695
BsmAI	GTCTC	1 cut(s)	80
BsmFI	GGGAC	2 cut(s)	256, 322
BsmI	GAATGC	1 cut(s)	589
BsnI	GGCC	4 cut(s)	260, 318, 565, 578
Bsp143I	GATC	2 cut(s)	85, 387
BspACI	CCGC	6 cut(s)	41, 340, 606, 621, 636, 651
BspANI	GGCC	4 cut(s)	260, 318, 565, 578
BspCNI	CTCAG	2 cut(s)	90, 475
BspLI	GGNNCC	3 cut(s)	119, 338, 536
BspPI	GGATC	2 cut(s)	80, 382
BspT107I	GGYRCC	2 cut(s)	117, 534
BspTI	CTTAAG	2 cut(s)	377, 398
BsrBI	CCGCTC	1 cut(s)	608
BssECI	CCNNGG	1 cut(s)	545
BssMI	GATC	2 cut(s)	85, 387
BssNI	GRCGYC	2 cut(s)	118, 177
Bst2UI	CCWGG	2 cut(s)	546, 580
Bst4CI	ACNGT	4 cut(s)	143, 246, 500, 506
Bst6I	CTCTTC	1 cut(s)	449
BstACI	GRCGYC	2 cut(s)	118, 177
BstAFI	CTTAAG	2 cut(s)	377, 398
BstC8I	GCNNGC	4 cut(s)	326, 330, 429, 516
BstDEI	CTNAG	5 cut(s)	59, 64, 77, 281, 483
BstENI	CCTNNNNNAGG	1 cut(s)	150
BstF5I	GGATG	5 cut(s)	22, 40, 456, 551, 726
BstH2I	RGCGCY	2 cut(s)	121, 561
BstHHI	GCGC	4 cut(s)	97, 120, 560, 661
BstKTI	GATC	2 cut(s)	88, 390
BstMAI	GTCTC	1 cut(s)	80
BstMBI	GATC	2 cut(s)	85, 387
BstMWI	GCNNNNNNNGC	3 cut(s)	185, 469, 584
BstNI	CCWGG	2 cut(s)	546, 580
BstNSI	RCATGY	1 cut(s)	425
BstSCI	CCNGG	2 cut(s)	544, 578
BstV1I	GCAGC	4 cut(s)	93, 219, 406, 459
BstV2I	GAAGAC	1 cut(s)	165
BstX2I	RGATCY	1 cut(s)	387
BstYI	RGATCY	1 cut(s)	387
BsuRI	GGCC	4 cut(s)	260, 318, 565, 578
BtsCI	GGATG	5 cut(s)	22, 40, 456, 551, 726
BtsIMutI	CAGTG	2 cut(s)	296, 505
Cac8I	GCNNGC	4 cut(s)	326, 330, 429, 516
CfoI	GCGC	4 cut(s)	97, 120, 560, 661
Cfr13I	GGNCC	4 cut(s)	143, 246, 316, 336
CpoI	CGGWCCG	1 cut(s)	246
CseI	GACGC	2 cut(s)	185, 507
Csp6I	GTAC	1 cut(s)	403
CspI	CGGWCCG	1 cut(s)	246
CviAII	CATG	2 cut(s)	313, 422
CviQI	GTAC	1 cut(s)	403
DdeI	CTNAG	5 cut(s)	59, 64, 77, 281, 483
DinI	GGCGCC	1 cut(s)	119
DpnI	GATC	2 cut(s)	87, 389
DpnII	GATC	2 cut(s)	85, 387
DraIII	CACNNNGTG	1 cut(s)	284
EaeI	YGGCCR	2 cut(s)	258, 563
Eam1104I	CTCTTC	1 cut(s)	449
EarI	CTCTTC	1 cut(s)	449
Eco147I	AGGCCT	1 cut(s)	578
Eco47I	GGWCC	3 cut(s)	143, 246, 336
Eco47III	AGCGCT	1 cut(s)	559
EcoNI	CCTNNNNNAGG	1 cut(s)	150
EcoRI	GAATTC	1 cut(s)	492
EcoRII	CCWGG	2 cut(s)	544, 578
EgeI	GGCGCC	1 cut(s)	119
EheI	GGCGCC	1 cut(s)	119
FaeI	CATG	2 cut(s)	316, 425
FaiI	YATR	7 cut(s)	115, 314, 423, 629, 644, 710, 773
FaqI	GGGAC	2 cut(s)	256, 322
FatI	CATG	2 cut(s)	312, 421
FauI	CCCGC	4 cut(s)	347, 613, 628, 643
Fnu4HI	GCNGC	5 cut(s)	42, 82, 233, 395, 473
FokI	GGATG	5 cut(s)	29, 47, 463, 538, 733
Fsp4HI	GCNGC	5 cut(s)	42, 82, 233, 395, 473
FspBI	CTAG	2 cut(s)	590, 737
GlaI	GCGC	4 cut(s)	96, 119, 559, 660
GluI	GCNGC	5 cut(s)	42, 82, 233, 395, 473
GsuI	CTGGAG	1 cut(s)	512
HaeII	RGCGCY	2 cut(s)	121, 561
HaeIII	GGCC	4 cut(s)	260, 318, 565, 578
HapII	CCGG	1 cut(s)	89
HgaI	GACGC	2 cut(s)	185, 507
HhaI	GCGC	4 cut(s)	97, 120, 560, 661
Hin1I	GRCGYC	2 cut(s)	118, 177
Hin1II	CATG	2 cut(s)	316, 425
Hin6I	GCGC	4 cut(s)	95, 118, 558, 659
HinP1I	GCGC	4 cut(s)	95, 118, 558, 659
HindIII	AAGCTT	1 cut(s)	461
HinfI	GANTC	5 cut(s)	73, 161, 269, 350, 479
HpaII	CCGG	1 cut(s)	89
HphI	GGTGA	2 cut(s)	38, 167
Hpy188I	TCNGA	4 cut(s)	250, 484, 597, 612
Hpy188III	TCNNGA	3 cut(s)	240, 266, 529
Hpy99I	CGWCG	1 cut(s)	448
HpyAV	CCTTC	3 cut(s)	132, 657, 736
HpyCH4III	ACNGT	4 cut(s)	143, 246, 500, 506
HpyCH4V	TGCA	4 cut(s)	172, 421, 431, 475
HpyF10VI	GCNNNNNNNGC	3 cut(s)	185, 469, 584
HpyF3I	CTNAG	5 cut(s)	59, 64, 77, 281, 483
Hsp92I	GRCGYC	2 cut(s)	118, 177
Hsp92II	CATG	2 cut(s)	316, 425
HspAI	GCGC	4 cut(s)	95, 118, 558, 659
KasI	GGCGCC	1 cut(s)	117
Kzo9I	GATC	2 cut(s)	85, 387
LmnI	GCTCC	2 cut(s)	598, 613
Lsp1109I	GCAGC	4 cut(s)	93, 219, 406, 459
LweI	GCATC	3 cut(s)	159, 588, 603
MaeI	CTAG	2 cut(s)	590, 737
MaeIII	GTNAC	1 cut(s)	500
MalI	GATC	2 cut(s)	87, 389
MbiI	CCGCTC	1 cut(s)	608
MboI	GATC	2 cut(s)	85, 387
MboII	GAAGA	3 cut(s)	126, 170, 466
MflI	RGATCY	1 cut(s)	387
MlsI	TGGCCA	1 cut(s)	565
MluCI	AATT	1 cut(s)	492
MluNI	TGGCCA	1 cut(s)	565
Mly113I	GGCGCC	1 cut(s)	118
MlyI	GAGTC	3 cut(s)	82, 155, 278
MmeI	TCCRAC	1 cut(s)	333
Mox20I	TGGCCA	1 cut(s)	565
MscI	TGGCCA	1 cut(s)	565
MseI	TTAA	2 cut(s)	378, 399
Msp20I	TGGCCA	1 cut(s)	565
MspCI	CTTAAG	2 cut(s)	377, 398
MspI	CCGG	1 cut(s)	89
MspR9I	CCNGG	2 cut(s)	546, 580
Mva1269I	GAATGC	1 cut(s)	589
MvaI	CCWGG	2 cut(s)	546, 580
MwoI	GCNNNNNNNGC	3 cut(s)	185, 469, 584
NarI	GGCGCC	1 cut(s)	118
NdeII	GATC	2 cut(s)	85, 387
NlaIII	CATG	2 cut(s)	316, 425
NlaIV	GGNNCC	3 cut(s)	119, 338, 536
NmuCI	GTSAC	1 cut(s)	500
NspI	RCATGY	1 cut(s)	425
PceI	AGGCCT	1 cut(s)	578
PctI	GAATGC	1 cut(s)	589
PfeI	GAWTC	2 cut(s)	350, 479
PflMI	CCANNNNNTGG	1 cut(s)	561
PkrI	GCNGC	5 cut(s)	43, 83, 234, 396, 474
PleI	GAGTC	3 cut(s)	81, 155, 277
PluTI	GGCGCC	1 cut(s)	121
PpsI	GAGTC	3 cut(s)	81, 155, 277
PsiI	TTATAA	1 cut(s)	710
Psp6I	CCWGG	2 cut(s)	544, 578
PspGI	CCWGG	2 cut(s)	544, 578
PspN4I	GGNNCC	3 cut(s)	119, 338, 536
PspPI	GGNCC	4 cut(s)	143, 246, 316, 336
PsuI	RGATCY	1 cut(s)	387
RsaI	GTAC	1 cut(s)	404
RsaNI	GTAC	1 cut(s)	403
Rsr2I	CGGWCCG	1 cut(s)	246
RsrII	CGGWCCG	1 cut(s)	246
SaqAI	TTAA	2 cut(s)	378, 399
SatI	GCNGC	5 cut(s)	42, 82, 233, 395, 473
Sau3AI	GATC	2 cut(s)	85, 387
Sau96I	GGNCC	4 cut(s)	143, 246, 316, 336
SchI	GAGTC	3 cut(s)	82, 155, 278
ScrFI	CCNGG	2 cut(s)	546, 580
SfaNI	GCATC	3 cut(s)	159, 588, 603
SfoI	GGCGCC	1 cut(s)	119
SinI	GGWCC	3 cut(s)	143, 246, 336
SmlI	CTYRAG	2 cut(s)	377, 398
SmoI	CTYRAG	2 cut(s)	377, 398
Sse9I	AATT	1 cut(s)	492
SseBI	AGGCCT	1 cut(s)	578
SsiI	CCGC	6 cut(s)	41, 340, 606, 621, 636, 651
SspDI	GGCGCC	1 cut(s)	117
SspMI	CTAG	2 cut(s)	590, 737
StuI	AGGCCT	1 cut(s)	578
StyD4I	CCNGG	2 cut(s)	544, 578
TaaI	ACNGT	4 cut(s)	143, 246, 500, 506
TaqI	TCGA	2 cut(s)	53, 490
TaqII	GACCGA	1 cut(s)	324
TasI	AATT	1 cut(s)	492
TauI	GCSGC	1 cut(s)	44
TfiI	GAWTC	2 cut(s)	350, 479
Tru1I	TTAA	2 cut(s)	378, 399
Tru9I	TTAA	2 cut(s)	378, 399
TscAI	CASTG	2 cut(s)	296, 505
TseFI	GTSAC	1 cut(s)	500
TseI	GCWGC	4 cut(s)	81, 232, 394, 472
Tsp45I	GTSAC	1 cut(s)	500
TspDTI	ATGAA	1 cut(s)	467
TspRI	CASTG	2 cut(s)	296, 505
Van91I	CCANNNNNTGG	1 cut(s)	561
Vha464I	CTTAAG	2 cut(s)	377, 398
VpaK11BI	GGWCC	3 cut(s)	143, 246, 336
XagI	CCTNNNNNAGG	1 cut(s)	150
XapI	RAATTY	1 cut(s)	492
XceI	RCATGY	1 cut(s)	425
XspI	CTAG	2 cut(s)	590, 737

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.