pycom06g05150

Nudix hydrolase 3-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr6
Physical Location & Seq
Forward (+)
7085913 .. 7090134
4222 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom06g05150.1

Sequence Viewer

Length: 561 bp
ATGAATGGTGCTGTTTTTGTATGTGAATGCATGCTGGAATTGAAAGGGAAAGCTGGAAAGGTGATGAAATGCACGGCACAAAAATGGTTGTTGGTGTCTACAATAGTAGCTAGGAACCTCCTCACTCCGAAAGATAGTAGGCTGCTGTCAGGACGGTCCGATGAGTTGGCCGTTCAAGAGTCCCTCGCACTTAGTGTTCAGTGTGCGAGTTCTGTGTCCAACATGGGCCAACGCCTGCTTGCCCGCTCCCGTCAGGTGGAATCATTGATGGCAGAGGTGGAAAGTCTCAAGCAGGAGATCCAGCAGCTGAAGTATGAGAATAGAAGTTTGCACGTGCTTGCAAACAACTATTCGACGGGCATGAAGAGGAAGCTTGATGAGCTGCAAGAGTCTGAAGGTCGGATTCACAGTGACCGTCAAAGGTTTTCGTCTTTCCTCCAGAGGCACCTTTTTCCTGGCTCATCCAGCGCTTGGCCAAGTATTGAGGCCTGGAATGCTCTATCTTCGATGCCTCCCGCTCCGATGTCTTCTGTTCCTACGCCTTCCAGTAAAGCCACGTAG

Protein Analysis

187

Amino Acids

20.59

Weight (kDa)

9.32

Isoelectric Point (pI)

63.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 444
AccB7I CCANNNNNTGG 1 cut(s) 471
AccBSI CCGCTC 2 cut(s) 246, 518
AccI GTMKAC 1 cut(s) 98
AciI CCGC 2 cut(s) 244, 516
AclWI GGATC 1 cut(s) 292
AcoI YGGCCR 2 cut(s) 168, 473
AcuI CTGAAG 2 cut(s) 329, 414
AcvI CACGTG 1 cut(s) 334
AdeI CACNNNGTG 1 cut(s) 194
AfeI AGCGCT 1 cut(s) 469
AfiI CCNNNNNNNGG 2 cut(s) 256, 471
AgsI TTSAA 2 cut(s) 43, 176
AjnI CCWGG 2 cut(s) 454, 488
AluBI AGCT 5 cut(s) 53, 110, 307, 373, 382
AluI AGCT 5 cut(s) 53, 110, 307, 373, 382
Alw26I GTCTC 1 cut(s) 290
AlwI GGATC 1 cut(s) 292
AlwNI CAGNNNCTG 1 cut(s) 307
Aor51HI AGCGCT 1 cut(s) 469
AoxI GGCC 4 cut(s) 168, 226, 473, 486
ApeKI GCWGC 3 cut(s) 142, 304, 382
AspLEI GCGC 1 cut(s) 470
AspS9I GGNCC 2 cut(s) 156, 226
AsuHPI GGTGA 1 cut(s) 73
AvaII GGWCC 1 cut(s) 156
BalI TGGCCA 1 cut(s) 475
BanI GGYRCC 1 cut(s) 444
BbrPI CACGTG 1 cut(s) 334
BbsI GAAGAC 1 cut(s) 519
BbvI GCAGC 3 cut(s) 129, 316, 369
BccI CCATC 1 cut(s) 262
BceAI ACGGC 2 cut(s) 90, 155
BciT130I CCWGG 2 cut(s) 456, 490
BcoDI GTCTC 1 cut(s) 290
BfaI CTAG 1 cut(s) 111
BfoI RGCGCY 1 cut(s) 471
BisI GCNGC 3 cut(s) 143, 305, 383
BlsI GCNGC 3 cut(s) 144, 306, 384
Bme1390I CCNGG 2 cut(s) 456, 490
Bme18I GGWCC 1 cut(s) 156
BmgT120I GGNCC 2 cut(s) 156, 226
BmiI GGNNCC 2 cut(s) 116, 446
BmrFI CCNGG 2 cut(s) 456, 490
BmsI GCATC 1 cut(s) 498
BpiI GAAGAC 1 cut(s) 519
BpmI CTGGAG 1 cut(s) 422
BpuEI CTTGAG 1 cut(s) 272
BsaAI YACGTR 2 cut(s) 334, 558
Bsc4I CCNNNNNNNGG 2 cut(s) 256, 471
Bse1I ACTGG 1 cut(s) 546
BseBI CCWGG 2 cut(s) 456, 490
BseGI GGATG 1 cut(s) 461
BseLI CCNNNNNNNGG 2 cut(s) 256, 471
BseNI ACTGG 1 cut(s) 546
BseRI GAGGAG 1 cut(s) 110
BseXI GCAGC 3 cut(s) 129, 316, 369
BshFI GGCC 4 cut(s) 170, 228, 475, 488
BshNI GGYRCC 1 cut(s) 444
BslFI GGGAC 1 cut(s) 166
BslI CCNNNNNNNGG 2 cut(s) 256, 471
BsmAI GTCTC 1 cut(s) 290
BsmFI GGGAC 1 cut(s) 166
BsmI GAATGC 2 cut(s) 32, 499
BsnI GGCC 4 cut(s) 170, 228, 475, 488
Bsp143I GATC 1 cut(s) 297
BspACI CCGC 2 cut(s) 244, 516
BspANI GGCC 4 cut(s) 170, 228, 475, 488
BspLI GGNNCC 2 cut(s) 116, 446
BspPI GGATC 1 cut(s) 292
BspT107I GGYRCC 1 cut(s) 444
BsrBI CCGCTC 2 cut(s) 246, 518
BsrI ACTGG 1 cut(s) 546
BssMI GATC 1 cut(s) 297
Bst2UI CCWGG 2 cut(s) 456, 490
Bst4CI ACNGT 3 cut(s) 156, 410, 416
Bst6I CTCTTC 1 cut(s) 359
BstBAI YACGTR 2 cut(s) 334, 558
BstC8I GCNNGC 5 cut(s) 32, 236, 240, 244, 339
BstDEI CTNAG 1 cut(s) 191
BstF5I GGATG 1 cut(s) 461
BstH2I RGCGCY 1 cut(s) 471
BstHHI GCGC 1 cut(s) 470
BstKTI GATC 1 cut(s) 300
BstMAI GTCTC 1 cut(s) 290
BstMBI GATC 1 cut(s) 297
BstMWI GCNNNNNNNGC 3 cut(s) 379, 465, 494
BstNI CCWGG 2 cut(s) 456, 490
BstNSI RCATGY 1 cut(s) 34
BstSCI CCNGG 2 cut(s) 454, 488
BstV1I GCAGC 3 cut(s) 129, 316, 369
BstV2I GAAGAC 1 cut(s) 519
BstX2I RGATCY 1 cut(s) 297
BstYI RGATCY 1 cut(s) 297
BsuRI GGCC 4 cut(s) 170, 228, 475, 488
BtsCI GGATG 1 cut(s) 461
BtsIMutI CAGTG 2 cut(s) 206, 415
Cac8I GCNNGC 5 cut(s) 32, 236, 240, 244, 339
CaiI CAGNNNCTG 1 cut(s) 307
CfoI GCGC 1 cut(s) 470
Cfr13I GGNCC 2 cut(s) 156, 226
CpoI CGGWCCG 1 cut(s) 156
CspI CGGWCCG 1 cut(s) 156
CviAII CATG 3 cut(s) 31, 223, 361
DdeI CTNAG 1 cut(s) 191
DpnI GATC 1 cut(s) 299
DpnII GATC 1 cut(s) 297
DraIII CACNNNGTG 1 cut(s) 194
EaeI YGGCCR 2 cut(s) 168, 473
Eam1104I CTCTTC 1 cut(s) 359
EarI CTCTTC 1 cut(s) 359
Eco147I AGGCCT 1 cut(s) 488
Eco47I GGWCC 1 cut(s) 156
Eco47III AGCGCT 1 cut(s) 469
Eco57I CTGAAG 2 cut(s) 329, 414
Eco72I CACGTG 1 cut(s) 334
EcoRII CCWGG 2 cut(s) 454, 488
EcoT22I ATGCAT 1 cut(s) 32
FaeI CATG 3 cut(s) 34, 226, 364
FaiI YATR 5 cut(s) 22, 32, 224, 315, 362
FaqI GGGAC 1 cut(s) 166
FatI CATG 3 cut(s) 30, 222, 360
FauI CCCGC 2 cut(s) 251, 523
FblI GTMKAC 1 cut(s) 98
Fnu4HI GCNGC 3 cut(s) 143, 305, 383
FokI GGATG 1 cut(s) 448
Fsp4HI GCNGC 3 cut(s) 143, 305, 383
FspBI CTAG 1 cut(s) 111
GlaI GCGC 1 cut(s) 469
GluI GCNGC 3 cut(s) 143, 305, 383
GsuI CTGGAG 1 cut(s) 422
HaeII RGCGCY 1 cut(s) 471
HaeIII GGCC 4 cut(s) 170, 228, 475, 488
HhaI GCGC 1 cut(s) 470
Hin1II CATG 3 cut(s) 34, 226, 364
Hin6I GCGC 1 cut(s) 468
HinP1I GCGC 1 cut(s) 468
HindIII AAGCTT 1 cut(s) 371
HinfI GANTC 4 cut(s) 179, 260, 389, 403
HphI GGTGA 1 cut(s) 73
Hpy166II GTNNAC 1 cut(s) 99
Hpy188I TCNGA 5 cut(s) 129, 160, 394, 402, 522
Hpy188III TCNNGA 3 cut(s) 150, 176, 439
Hpy8I GTNNAC 1 cut(s) 99
Hpy99I CGWCG 1 cut(s) 358
HpyAV CCTTC 2 cut(s) 389, 552
HpyCH4III ACNGT 3 cut(s) 156, 410, 416
HpyCH4IV ACGT 2 cut(s) 333, 557
HpyCH4V TGCA 5 cut(s) 30, 72, 331, 341, 385
HpyF10VI GCNNNNNNNGC 3 cut(s) 379, 465, 494
HpyF3I CTNAG 1 cut(s) 191
HpySE526I ACGT 2 cut(s) 333, 557
Hsp92II CATG 3 cut(s) 34, 226, 364
HspAI GCGC 1 cut(s) 468
Kzo9I GATC 1 cut(s) 297
LmnI GCTCC 2 cut(s) 251, 523
Lsp1109I GCAGC 3 cut(s) 129, 316, 369
LweI GCATC 1 cut(s) 498
MaeI CTAG 1 cut(s) 111
MaeII ACGT 2 cut(s) 333, 557
MaeIII GTNAC 1 cut(s) 410
MalI GATC 1 cut(s) 299
MbiI CCGCTC 2 cut(s) 246, 518
MboI GATC 1 cut(s) 297
MboII GAAGA 3 cut(s) 376, 495, 519
MflI RGATCY 1 cut(s) 297
MlsI TGGCCA 1 cut(s) 475
MluCI AATT 1 cut(s) 38
MluNI TGGCCA 1 cut(s) 475
MlyI GAGTC 2 cut(s) 188, 398
MmeI TCCRAC 2 cut(s) 243, 380
MnlI CCTC 9 cut(s) 128, 131, 194, 268, 360, 435, 446, 478, 522
Mox20I TGGCCA 1 cut(s) 475
Mph1103I ATGCAT 1 cut(s) 32
MscI TGGCCA 1 cut(s) 475
MslI CAYNNNNRTG 1 cut(s) 82
Msp20I TGGCCA 1 cut(s) 475
MspA1I CMGCKG 1 cut(s) 307
MspR9I CCNGG 2 cut(s) 456, 490
Mva1269I GAATGC 2 cut(s) 32, 499
MvaI CCWGG 2 cut(s) 456, 490
MwoI GCNNNNNNNGC 3 cut(s) 379, 465, 494
NdeII GATC 1 cut(s) 297
NlaIII CATG 3 cut(s) 34, 226, 364
NlaIV GGNNCC 2 cut(s) 116, 446
NmuCI GTSAC 1 cut(s) 410
NsiI ATGCAT 1 cut(s) 32
NspI RCATGY 1 cut(s) 34
PaeI GCATGC 1 cut(s) 34
PceI AGGCCT 1 cut(s) 488
PctI GAATGC 2 cut(s) 32, 499
PfeI GAWTC 2 cut(s) 260, 403
PflMI CCANNNNNTGG 1 cut(s) 471
PkrI GCNGC 3 cut(s) 144, 306, 384
PleI GAGTC 2 cut(s) 187, 397
PmaCI CACGTG 1 cut(s) 334
PmlI CACGTG 1 cut(s) 334
PpsI GAGTC 2 cut(s) 187, 397
Ppu21I YACGTR 2 cut(s) 334, 558
Psp6I CCWGG 2 cut(s) 454, 488
PspCI CACGTG 1 cut(s) 334
PspGI CCWGG 2 cut(s) 454, 488
PspN4I GGNNCC 2 cut(s) 116, 446
PspPI GGNCC 2 cut(s) 156, 226
PstNI CAGNNNCTG 1 cut(s) 307
PsuI RGATCY 1 cut(s) 297
PvuII CAGCTG 1 cut(s) 307
RseI CAYNNNNRTG 1 cut(s) 82
Rsr2I CGGWCCG 1 cut(s) 156
RsrII CGGWCCG 1 cut(s) 156
SatI GCNGC 3 cut(s) 143, 305, 383
Sau3AI GATC 1 cut(s) 297
Sau96I GGNCC 2 cut(s) 156, 226
SchI GAGTC 2 cut(s) 188, 398
ScrFI CCNGG 2 cut(s) 456, 490
SfaNI GCATC 1 cut(s) 498
SinI GGWCC 1 cut(s) 156
SmiMI CAYNNNNRTG 1 cut(s) 82
SmlI CTYRAG 1 cut(s) 287
SmoI CTYRAG 1 cut(s) 287
SphI GCATGC 1 cut(s) 34
Sse9I AATT 1 cut(s) 38
SseBI AGGCCT 1 cut(s) 488
SsiI CCGC 2 cut(s) 244, 516
SspMI CTAG 1 cut(s) 111
StuI AGGCCT 1 cut(s) 488
StyD4I CCNGG 2 cut(s) 454, 488
TaaI ACNGT 3 cut(s) 156, 410, 416
TaiI ACGT 2 cut(s) 336, 560
TaqI TCGA 2 cut(s) 353, 506
TasI AATT 1 cut(s) 38
TfiI GAWTC 2 cut(s) 260, 403
TscAI CASTG 2 cut(s) 206, 415
TseFI GTSAC 1 cut(s) 410
TseI GCWGC 3 cut(s) 142, 304, 382
Tsp45I GTSAC 1 cut(s) 410
TspDTI ATGAA 3 cut(s) 17, 80, 377
TspRI CASTG 2 cut(s) 206, 415
Van91I CCANNNNNTGG 1 cut(s) 471
VpaK11BI GGWCC 1 cut(s) 156
XceI RCATGY 1 cut(s) 34
XmiI GTMKAC 1 cut(s) 98
XspI CTAG 1 cut(s) 111
Zsp2I ATGCAT 1 cut(s) 32
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.