Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

tig00001774

Orthogroup ID

OG0000120

Physical Location & Seq

Genomic Coordinates Forward (+)

4348 .. 11185

Gene Structure 6838 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom1774g00010.2

Sequence Viewer

CDS Protein Promoter (2k)

Length: 696 bp

ATGGCAAACTCATCGAACCTTAGCTTAGATTTGAGTCTCAGCAGCGATCCGGTTGCGCCCCGTCAAGGTAATGTATGGCGCCCTTCTTTTTTATCTTCTAACGGTCCTCTTTCAGGTGAAGACTCTGTGATGCAGGACGCCACAACAGCTACAATAGTAGCTAAAAACCTCCTCACTCCAAAAGATAGTAGGCTGCTGTCAGGACGGTCCGATGAGTTGGCCGTTCAAGAGTCCCTCGCACTTAGTGTTCAGTGTGCGAGTTCTGTGTCCAACATGGGCCAACGCCTGCTTGCTCGGTCCCGCCAAGTGGAATCGTTGATGGCAGAGGTGGAAAGACTTAAGCAAGAGATCCAGCAGCTTAAGTACGAGAATAGAAGTTTGCATGTGCTTGCAAATAACTATTCGTCGGGGATGAAGAGGAAGCTTGATGAGCTGCAAGAATCTGAGGGTCGAATTCACAGTGACCGTCAAAGTCAAAGTGACCGTCAAAGGTTTTCGTCTTTCCTCCAGAGGCACCTTTTTCCTGGATCATCCAGCGTTTGGCCAAGTATTGAGGCCTCGAATGCTCTATCTTCGATGCCTCTAGCTCCGATGCCTTCCGCTCCTATGTCTTCTGCCCCGATGCCTTCCGTCTCGATGCCTTCCGCTTCAAGAGTTTTGCCACGTAGTGGGTCTTTAAGTAAACAACCTTTGTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004177 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005829 GO:0006508 GO:0006807 GO:0008150 GO:0008152 GO:0008233 GO:0008238 GO:0008239 GO:0016787 GO:0019538 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044238 GO:0044424 GO:0044444 GO:0044464 GO:0070011 GO:0071704 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

NUDIX Peptidase_M49

Protein Analysis

232

Amino Acids

25.13

Weight (kDa)

9.24

Isoelectric Point (pI)

72.61

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000120)

Species	Orthologous Gene IDs
malus_domestica	MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica	Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis	pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	2 cut(s)	78, 513
AccB7I	CCANNNNNTGG	2 cut(s)	540, 668
AccBSI	CCGCTC	1 cut(s)	602
AciI	CCGC	3 cut(s)	301, 600, 645
AclWI	GGATC	3 cut(s)	41, 343, 535
AcoI	YGGCCR	2 cut(s)	219, 542
AcsI	RAATTY	1 cut(s)	453
AcyI	GRCGYC	2 cut(s)	79, 138
AdeI	CACNNNGTG	2 cut(s)	245, 668
AfaI	GTAC	1 cut(s)	365
AfiI	CCNNNNNNNGG	5 cut(s)	65, 113, 307, 540, 668
AflII	CTTAAG	2 cut(s)	338, 359
AgsI	TTSAA	2 cut(s)	227, 651
AjnI	CCWGG	1 cut(s)	523
AluBI	AGCT	7 cut(s)	24, 149, 161, 358, 424, 433, 587
AluI	AGCT	7 cut(s)	24, 149, 161, 358, 424, 433, 587
Alw26I	GTCTC	2 cut(s)	41, 637
AlwI	GGATC	3 cut(s)	41, 343, 535
AoxI	GGCC	4 cut(s)	219, 277, 542, 555
ApeKI	GCWGC	4 cut(s)	42, 193, 355, 433
ApoI	RAATTY	1 cut(s)	453
ArsI	GACNNNNNNTTYG	2 cut(s)	469, 501
AspLEI	GCGC	2 cut(s)	58, 81
AspS9I	GGNCC	4 cut(s)	104, 207, 277, 297
AsuHPI	GGTGA	1 cut(s)	128
AvaII	GGWCC	3 cut(s)	104, 207, 297
BalI	TGGCCA	1 cut(s)	544
BanI	GGYRCC	2 cut(s)	78, 513
BbsI	GAAGAC	2 cut(s)	126, 603
BbvI	GCAGC	4 cut(s)	54, 180, 367, 420
BccI	CCATC	1 cut(s)	313
BceAI	ACGGC	1 cut(s)	206
BcgI	CGANNNNNNTGC	3 cut(s)	28, 35, 69
BciT130I	CCWGG	1 cut(s)	525
BcoDI	GTCTC	2 cut(s)	41, 637
BfaI	CTAG	1 cut(s)	584
BfoI	RGCGCY	1 cut(s)	82
BfrI	CTTAAG	2 cut(s)	338, 359
BisI	GCNGC	4 cut(s)	43, 194, 356, 434
BlsI	GCNGC	4 cut(s)	44, 195, 357, 435
Bme1390I	CCNGG	1 cut(s)	525
Bme18I	GGWCC	3 cut(s)	104, 207, 297
BmgT120I	GGNCC	4 cut(s)	104, 207, 277, 297
BmiI	GGNNCC	3 cut(s)	80, 299, 515
BmrFI	CCNGG	1 cut(s)	525
BmsI	GCATC	5 cut(s)	120, 567, 582, 612, 627
BpiI	GAAGAC	2 cut(s)	126, 603
BpmI	CTGGAG	1 cut(s)	491
Bpu10I	CCTNAGC	1 cut(s)	20
BsaAI	YACGTR	1 cut(s)	665
BsaHI	GRCGYC	2 cut(s)	79, 138
BsaWI	WCCGGW	1 cut(s)	49
Bsc4I	CCNNNNNNNGG	5 cut(s)	65, 113, 307, 540, 668
BseBI	CCWGG	1 cut(s)	525
BseGI	GGATG	2 cut(s)	417, 530
BseLI	CCNNNNNNNGG	5 cut(s)	65, 113, 307, 540, 668
BseMII	CTCAG	2 cut(s)	52, 435
BseRI	GAGGAG	1 cut(s)	161
BseXI	GCAGC	4 cut(s)	54, 180, 367, 420
BshFI	GGCC	4 cut(s)	221, 279, 544, 557
BshNI	GGYRCC	2 cut(s)	78, 513
BsiSI	CCGG	1 cut(s)	50
BslFI	GGGAC	2 cut(s)	217, 283
BslI	CCNNNNNNNGG	5 cut(s)	65, 113, 307, 540, 668
BsmAI	GTCTC	2 cut(s)	41, 637
BsmBI	CGTCTC	1 cut(s)	637
BsmFI	GGGAC	2 cut(s)	217, 283
BsmI	GAATGC	1 cut(s)	568
BsnI	GGCC	4 cut(s)	221, 279, 544, 557
Bsp143I	GATC	3 cut(s)	46, 348, 527
BspACI	CCGC	3 cut(s)	301, 600, 645
BspANI	GGCC	4 cut(s)	221, 279, 544, 557
BspCNI	CTCAG	2 cut(s)	51, 436
BspLI	GGNNCC	3 cut(s)	80, 299, 515
BspPI	GGATC	3 cut(s)	41, 343, 535
BspT107I	GGYRCC	2 cut(s)	78, 513
BspTI	CTTAAG	2 cut(s)	338, 359
BsrBI	CCGCTC	1 cut(s)	602
BssMI	GATC	3 cut(s)	46, 348, 527
BssNI	GRCGYC	2 cut(s)	79, 138
Bst2UI	CCWGG	1 cut(s)	525
Bst4CI	ACNGT	5 cut(s)	104, 207, 461, 467, 485
Bst6I	CTCTTC	1 cut(s)	410
BstACI	GRCGYC	2 cut(s)	79, 138
BstAFI	CTTAAG	2 cut(s)	338, 359
BstBAI	YACGTR	1 cut(s)	665
BstC8I	GCNNGC	3 cut(s)	287, 291, 390
BstDEI	CTNAG	5 cut(s)	20, 25, 38, 242, 444
BstENI	CCTNNNNNAGG	1 cut(s)	111
BstF5I	GGATG	2 cut(s)	417, 530
BstH2I	RGCGCY	1 cut(s)	82
BstHHI	GCGC	2 cut(s)	58, 81
BstKTI	GATC	3 cut(s)	49, 351, 530
BstMAI	GTCTC	2 cut(s)	41, 637
BstMBI	GATC	3 cut(s)	46, 348, 527
BstMWI	GCNNNNNNNGC	3 cut(s)	146, 430, 563
BstNI	CCWGG	1 cut(s)	525
BstNSI	RCATGY	1 cut(s)	386
BstSCI	CCNGG	1 cut(s)	523
BstV1I	GCAGC	4 cut(s)	54, 180, 367, 420
BstV2I	GAAGAC	2 cut(s)	126, 603
BstX2I	RGATCY	1 cut(s)	348
BstYI	RGATCY	1 cut(s)	348
BsuRI	GGCC	4 cut(s)	221, 279, 544, 557
BtsCI	GGATG	2 cut(s)	417, 530
BtsIMutI	CAGTG	2 cut(s)	257, 466
Cac8I	GCNNGC	3 cut(s)	287, 291, 390
CfoI	GCGC	2 cut(s)	58, 81
Cfr13I	GGNCC	4 cut(s)	104, 207, 277, 297
CpoI	CGGWCCG	1 cut(s)	207
CseI	GACGC	1 cut(s)	146
Csp6I	GTAC	1 cut(s)	364
CspI	CGGWCCG	1 cut(s)	207
CviAII	CATG	2 cut(s)	274, 383
CviQI	GTAC	1 cut(s)	364
DdeI	CTNAG	5 cut(s)	20, 25, 38, 242, 444
DinI	GGCGCC	1 cut(s)	80
DpnI	GATC	3 cut(s)	48, 350, 529
DpnII	GATC	3 cut(s)	46, 348, 527
DraIII	CACNNNGTG	2 cut(s)	245, 668
EaeI	YGGCCR	2 cut(s)	219, 542
Eam1104I	CTCTTC	1 cut(s)	410
EarI	CTCTTC	1 cut(s)	410
Eco147I	AGGCCT	1 cut(s)	557
Eco47I	GGWCC	3 cut(s)	104, 207, 297
EcoNI	CCTNNNNNAGG	1 cut(s)	111
EcoRI	GAATTC	1 cut(s)	453
EcoRII	CCWGG	1 cut(s)	523
EgeI	GGCGCC	1 cut(s)	80
EheI	GGCGCC	1 cut(s)	80
Esp3I	CGTCTC	1 cut(s)	637
FaeI	CATG	2 cut(s)	277, 386
FaiI	YATR	4 cut(s)	76, 275, 384, 608
FaqI	GGGAC	2 cut(s)	217, 283
FatI	CATG	2 cut(s)	273, 382
FauI	CCCGC	1 cut(s)	308
Fnu4HI	GCNGC	4 cut(s)	43, 194, 356, 434
FokI	GGATG	2 cut(s)	424, 517
Fsp4HI	GCNGC	4 cut(s)	43, 194, 356, 434
FspBI	CTAG	1 cut(s)	584
GlaI	GCGC	2 cut(s)	57, 80
GluI	GCNGC	4 cut(s)	43, 194, 356, 434
GsuI	CTGGAG	1 cut(s)	491
HaeII	RGCGCY	1 cut(s)	82
HaeIII	GGCC	4 cut(s)	221, 279, 544, 557
HapII	CCGG	1 cut(s)	50
HgaI	GACGC	1 cut(s)	146
HhaI	GCGC	2 cut(s)	58, 81
Hin1I	GRCGYC	2 cut(s)	79, 138
Hin1II	CATG	2 cut(s)	277, 386
Hin6I	GCGC	2 cut(s)	56, 79
HinP1I	GCGC	2 cut(s)	56, 79
HindIII	AAGCTT	1 cut(s)	422
HinfI	GANTC	5 cut(s)	34, 122, 230, 311, 440
HpaII	CCGG	1 cut(s)	50
HphI	GGTGA	1 cut(s)	128
Hpy166II	GTNNAC	1 cut(s)	683
Hpy188I	TCNGA	3 cut(s)	211, 445, 591
Hpy188III	TCNNGA	5 cut(s)	201, 227, 508, 634, 651
Hpy8I	GTNNAC	1 cut(s)	683
Hpy99I	CGWCG	1 cut(s)	409
HpyAV	CCTTC	4 cut(s)	93, 606, 636, 651
HpyCH4III	ACNGT	5 cut(s)	104, 207, 461, 467, 485
HpyCH4IV	ACGT	1 cut(s)	664
HpyCH4V	TGCA	4 cut(s)	133, 382, 392, 436
HpyF10VI	GCNNNNNNNGC	3 cut(s)	146, 430, 563
HpyF3I	CTNAG	5 cut(s)	20, 25, 38, 242, 444
HpySE526I	ACGT	1 cut(s)	664
Hsp92I	GRCGYC	2 cut(s)	79, 138
Hsp92II	CATG	2 cut(s)	277, 386
HspAI	GCGC	2 cut(s)	56, 79
KasI	GGCGCC	1 cut(s)	78
Kzo9I	GATC	3 cut(s)	46, 348, 527
LmnI	GCTCC	2 cut(s)	592, 607
Lsp1109I	GCAGC	4 cut(s)	54, 180, 367, 420
LweI	GCATC	5 cut(s)	120, 567, 582, 612, 627
MaeI	CTAG	1 cut(s)	584
MaeII	ACGT	1 cut(s)	664
MaeIII	GTNAC	2 cut(s)	461, 479
MalI	GATC	3 cut(s)	48, 350, 529
MbiI	CCGCTC	1 cut(s)	602
MboI	GATC	3 cut(s)	46, 348, 527
MboII	GAAGA	5 cut(s)	87, 131, 427, 564, 603
MflI	RGATCY	1 cut(s)	348
MlsI	TGGCCA	1 cut(s)	544
MluCI	AATT	1 cut(s)	453
MluNI	TGGCCA	1 cut(s)	544
Mly113I	GGCGCC	1 cut(s)	79
MlyI	GAGTC	3 cut(s)	43, 116, 239
MmeI	TCCRAC	1 cut(s)	294
Mox20I	TGGCCA	1 cut(s)	544
MscI	TGGCCA	1 cut(s)	544
MseI	TTAA	3 cut(s)	339, 360, 677
Msp20I	TGGCCA	1 cut(s)	544
MspCI	CTTAAG	2 cut(s)	338, 359
MspI	CCGG	1 cut(s)	50
MspR9I	CCNGG	1 cut(s)	525
Mva1269I	GAATGC	1 cut(s)	568
MvaI	CCWGG	1 cut(s)	525
MwoI	GCNNNNNNNGC	3 cut(s)	146, 430, 563
NarI	GGCGCC	1 cut(s)	79
NdeII	GATC	3 cut(s)	46, 348, 527
NlaIII	CATG	2 cut(s)	277, 386
NlaIV	GGNNCC	3 cut(s)	80, 299, 515
NmuCI	GTSAC	2 cut(s)	461, 479
NspI	RCATGY	1 cut(s)	386
PceI	AGGCCT	1 cut(s)	557
PctI	GAATGC	1 cut(s)	568
PfeI	GAWTC	2 cut(s)	311, 440
PflMI	CCANNNNNTGG	2 cut(s)	540, 668
PfoI	TCCNGGA	1 cut(s)	523
PkrI	GCNGC	4 cut(s)	44, 195, 357, 435
PleI	GAGTC	3 cut(s)	42, 116, 238
PluTI	GGCGCC	1 cut(s)	82
PpsI	GAGTC	3 cut(s)	42, 116, 238
Ppu21I	YACGTR	1 cut(s)	665
Psp6I	CCWGG	1 cut(s)	523
PspGI	CCWGG	1 cut(s)	523
PspN4I	GGNNCC	3 cut(s)	80, 299, 515
PspPI	GGNCC	4 cut(s)	104, 207, 277, 297
PsuI	RGATCY	1 cut(s)	348
RsaI	GTAC	1 cut(s)	365
RsaNI	GTAC	1 cut(s)	364
Rsr2I	CGGWCCG	1 cut(s)	207
RsrII	CGGWCCG	1 cut(s)	207
SaqAI	TTAA	3 cut(s)	339, 360, 677
SatI	GCNGC	4 cut(s)	43, 194, 356, 434
Sau3AI	GATC	3 cut(s)	46, 348, 527
Sau96I	GGNCC	4 cut(s)	104, 207, 277, 297
SchI	GAGTC	3 cut(s)	43, 116, 239
ScrFI	CCNGG	1 cut(s)	525
SfaNI	GCATC	5 cut(s)	120, 567, 582, 612, 627
SfoI	GGCGCC	1 cut(s)	80
SinI	GGWCC	3 cut(s)	104, 207, 297
SmlI	CTYRAG	2 cut(s)	338, 359
SmoI	CTYRAG	2 cut(s)	338, 359
Sse9I	AATT	1 cut(s)	453
SseBI	AGGCCT	1 cut(s)	557
SsiI	CCGC	3 cut(s)	301, 600, 645
SspDI	GGCGCC	1 cut(s)	78
SspMI	CTAG	1 cut(s)	584
StuI	AGGCCT	1 cut(s)	557
StyD4I	CCNGG	1 cut(s)	523
TaaI	ACNGT	5 cut(s)	104, 207, 461, 467, 485
TaiI	ACGT	1 cut(s)	667
TaqI	TCGA	5 cut(s)	14, 451, 560, 575, 635
TaqII	GACCGA	1 cut(s)	285
TasI	AATT	1 cut(s)	453
TfiI	GAWTC	2 cut(s)	311, 440
Tru1I	TTAA	3 cut(s)	339, 360, 677
Tru9I	TTAA	3 cut(s)	339, 360, 677
TscAI	CASTG	2 cut(s)	257, 466
TseFI	GTSAC	2 cut(s)	461, 479
TseI	GCWGC	4 cut(s)	42, 193, 355, 433
Tsp45I	GTSAC	2 cut(s)	461, 479
TspDTI	ATGAA	1 cut(s)	428
TspGWI	ACGGA	1 cut(s)	619
TspRI	CASTG	2 cut(s)	257, 466
Van91I	CCANNNNNTGG	2 cut(s)	540, 668
Vha464I	CTTAAG	2 cut(s)	338, 359
VpaK11BI	GGWCC	3 cut(s)	104, 207, 297
XagI	CCTNNNNNAGG	1 cut(s)	111
XapI	RAATTY	1 cut(s)	453
XceI	RCATGY	1 cut(s)	386
XspI	CTAG	1 cut(s)	584

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.