pycom15g35030

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
OG0000120
Physical Location & Seq
Reverse (-)
34936453 .. 34936855
403 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom15g35030.1

Sequence Viewer

Length: 345 bp
ATGCACACTTTGCTCATTTGTGAAAATCGTCTTCGGCCCTTTCAGATTTTACTCCATCCACCTTTCTCTTTTAACCCTTTGACAATGGCTAACACGTCGAACATTTGCTTAGATTTGAGTCTCAGCAGTGATCCGAGTGCGCCGCGTCAGGTAAATGTATGGTGCCCTTCTTTCTTTTCTTCTAATGGCCCTTTGACAGGTGAAGACTCTATAGTAGGCTGCTTTCAGAACGGTCCGATGAGTTGGCCGTTCAGGAGTCCCTCGCTCTCAGTGTTCAGTGCGCAGGCTCTGTGTCCAACATGGGCCAACGCTTACTTGCTCGATCCCACCAAGTGGAATCATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

115

Amino Acids

12.7

Weight (kDa)

6.22

Isoelectric Point (pI)

52.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 282
AccB1I GGYRCC 1 cut(s) 162
AccB7I CCANNNNNTGG 1 cut(s) 333
AccII CGCG 1 cut(s) 145
AciI CCGC 1 cut(s) 143
AclWI GGATC 2 cut(s) 125, 317
AcoI YGGCCR 1 cut(s) 245
AdeI CACNNNGTG 1 cut(s) 333
AfiI CCNNNNNNNGG 2 cut(s) 197, 333
AflIII ACRYGT 1 cut(s) 93
AjiI CACGTC 1 cut(s) 96
Alw26I GTCTC 1 cut(s) 125
AlwI GGATC 2 cut(s) 125, 317
AlwNI CAGNNNCTG 1 cut(s) 289
AoxI GGCC 4 cut(s) 35, 187, 245, 303
ApeKI GCWGC 1 cut(s) 219
AspLEI GCGC 2 cut(s) 142, 283
AspS9I GGNCC 4 cut(s) 36, 188, 233, 303
AsuHPI GGTGA 1 cut(s) 212
AvaII GGWCC 1 cut(s) 233
BaeGI GKGCMC 1 cut(s) 167
BanI GGYRCC 1 cut(s) 162
BbsI GAAGAC 2 cut(s) 23, 210
BbvI GCAGC 1 cut(s) 206
BccI CCATC 1 cut(s) 63
BceAI ACGGC 1 cut(s) 232
BcoDI GTCTC 1 cut(s) 125
BfmI CTRYAG 1 cut(s) 210
BisI GCNGC 2 cut(s) 143, 220
BlsI GCNGC 2 cut(s) 144, 221
Bme18I GGWCC 1 cut(s) 233
BmgBI CACGTC 1 cut(s) 96
BmgT120I GGNCC 4 cut(s) 36, 188, 233, 303
BmiI GGNNCC 1 cut(s) 164
BpiI GAAGAC 2 cut(s) 23, 210
Bsc4I CCNNNNNNNGG 2 cut(s) 197, 333
BseGI GGATG 1 cut(s) 55
BseLI CCNNNNNNNGG 2 cut(s) 197, 333
BseMII CTCAG 2 cut(s) 136, 282
BseSI GKGCMC 1 cut(s) 167
BseXI GCAGC 1 cut(s) 206
Bsh1236I CGCG 1 cut(s) 145
BshFI GGCC 4 cut(s) 37, 189, 247, 305
BshNI GGYRCC 1 cut(s) 162
BslFI GGGAC 1 cut(s) 243
BslI CCNNNNNNNGG 2 cut(s) 197, 333
BsmAI GTCTC 1 cut(s) 125
BsmFI GGGAC 1 cut(s) 243
BsnI GGCC 4 cut(s) 37, 189, 247, 305
Bsp1286I GDGCHC 1 cut(s) 167
Bsp143I GATC 2 cut(s) 130, 322
BspACI CCGC 1 cut(s) 143
BspANI GGCC 4 cut(s) 37, 189, 247, 305
BspCNI CTCAG 2 cut(s) 135, 281
BspFNI CGCG 1 cut(s) 145
BspLI GGNNCC 1 cut(s) 164
BspPI GGATC 2 cut(s) 125, 317
BspT107I GGYRCC 1 cut(s) 162
BssMI GATC 2 cut(s) 130, 322
Bst4CI ACNGT 1 cut(s) 233
BstAPI GCANNNNNTGC 1 cut(s) 10
BstC8I GCNNGC 1 cut(s) 285
BstDEI CTNAG 3 cut(s) 109, 122, 268
BstENI CCTNNNNNAGG 1 cut(s) 195
BstF5I GGATG 1 cut(s) 55
BstFNI CGCG 1 cut(s) 145
BstHHI GCGC 2 cut(s) 142, 283
BstKTI GATC 2 cut(s) 133, 325
BstMAI GTCTC 1 cut(s) 125
BstMBI GATC 2 cut(s) 130, 322
BstMWI GCNNNNNNNGC 1 cut(s) 10
BstSFI CTRYAG 1 cut(s) 210
BstSLI GKGCMC 1 cut(s) 167
BstUI CGCG 1 cut(s) 145
BstV1I GCAGC 1 cut(s) 206
BstV2I GAAGAC 2 cut(s) 23, 210
BsuRI GGCC 4 cut(s) 37, 189, 247, 305
BtrI CACGTC 1 cut(s) 96
BtsCI GGATG 1 cut(s) 55
BtsI GCAGTG 1 cut(s) 133
BtsIMutI CAGTG 3 cut(s) 133, 276, 283
Cac8I GCNNGC 1 cut(s) 285
CaiI CAGNNNCTG 1 cut(s) 289
CfoI GCGC 2 cut(s) 142, 283
Cfr13I GGNCC 4 cut(s) 36, 188, 233, 303
CpoI CGGWCCG 1 cut(s) 233
CseI GACGC 1 cut(s) 134
CspI CGGWCCG 1 cut(s) 233
CviAII CATG 1 cut(s) 300
CviJI RGCY 7 cut(s) 37, 89, 189, 219, 247, 287, 305
CviKI_1 RGCY 7 cut(s) 37, 89, 189, 219, 247, 287, 305
DdeI CTNAG 3 cut(s) 109, 122, 268
DpnI GATC 2 cut(s) 132, 324
DpnII GATC 2 cut(s) 130, 322
DraIII CACNNNGTG 1 cut(s) 333
EaeI YGGCCR 1 cut(s) 245
Eco47I GGWCC 1 cut(s) 233
EcoNI CCTNNNNNAGG 1 cut(s) 195
FaeI CATG 1 cut(s) 303
FaiI YATR 3 cut(s) 160, 212, 301
FaqI GGGAC 1 cut(s) 243
FatI CATG 1 cut(s) 299
Fnu4HI GCNGC 2 cut(s) 143, 220
FokI GGATG 1 cut(s) 42
Fsp4HI GCNGC 2 cut(s) 143, 220
FspI TGCGCA 1 cut(s) 282
GlaI GCGC 2 cut(s) 141, 282
GluI GCNGC 2 cut(s) 143, 220
HaeIII GGCC 4 cut(s) 37, 189, 247, 305
HgaI GACGC 1 cut(s) 134
HhaI GCGC 2 cut(s) 142, 283
Hin1II CATG 1 cut(s) 303
Hin6I GCGC 2 cut(s) 140, 281
HinP1I GCGC 2 cut(s) 140, 281
HinfI GANTC 4 cut(s) 118, 206, 256, 337
HphI GGTGA 1 cut(s) 212
Hpy188I TCNGA 4 cut(s) 45, 135, 228, 237
Hpy188III TCNNGA 1 cut(s) 253
Hpy99I CGWCG 1 cut(s) 100
HpyAV CCTTC 1 cut(s) 177
HpyCH4III ACNGT 1 cut(s) 233
HpyCH4IV ACGT 1 cut(s) 95
HpyCH4V TGCA 1 cut(s) 4
HpyF10VI GCNNNNNNNGC 1 cut(s) 10
HpyF3I CTNAG 3 cut(s) 109, 122, 268
HpySE526I ACGT 1 cut(s) 95
Hsp92II CATG 1 cut(s) 303
HspAI GCGC 2 cut(s) 140, 281
Kzo9I GATC 2 cut(s) 130, 322
LpnPI CCDG 4 cut(s) 134, 183, 238, 269
Lsp1109I GCAGC 1 cut(s) 206
MaeII ACGT 1 cut(s) 95
MalI GATC 2 cut(s) 132, 324
MboI GATC 2 cut(s) 130, 322
MboII GAAGA 3 cut(s) 23, 171, 215
MhlI GDGCHC 1 cut(s) 167
MlyI GAGTC 3 cut(s) 127, 200, 265
MmeI TCCRAC 1 cut(s) 320
MnlI CCTC 1 cut(s) 271
MseI TTAA 1 cut(s) 72
MvnI CGCG 1 cut(s) 145
MwoI GCNNNNNNNGC 1 cut(s) 10
NdeII GATC 2 cut(s) 130, 322
NlaIII CATG 1 cut(s) 303
NlaIV GGNNCC 1 cut(s) 164
NsbI TGCGCA 1 cut(s) 282
PfeI GAWTC 1 cut(s) 337
PflMI CCANNNNNTGG 1 cut(s) 333
PkrI GCNGC 2 cut(s) 144, 221
PleI GAGTC 3 cut(s) 126, 200, 264
PpsI GAGTC 3 cut(s) 126, 200, 264
PspN4I GGNNCC 1 cut(s) 164
PspPI GGNCC 4 cut(s) 36, 188, 233, 303
PstNI CAGNNNCTG 1 cut(s) 289
Rsr2I CGGWCCG 1 cut(s) 233
RsrII CGGWCCG 1 cut(s) 233
SaqAI TTAA 1 cut(s) 72
SatI GCNGC 2 cut(s) 143, 220
Sau3AI GATC 2 cut(s) 130, 322
Sau96I GGNCC 4 cut(s) 36, 188, 233, 303
SchI GAGTC 3 cut(s) 127, 200, 265
SduI GDGCHC 1 cut(s) 167
SetI ASST 4 cut(s) 64, 98, 153, 202
SfcI CTRYAG 1 cut(s) 210
SinI GGWCC 1 cut(s) 233
SsiI CCGC 1 cut(s) 143
TaaI ACNGT 1 cut(s) 233
TaiI ACGT 1 cut(s) 98
TaqI TCGA 2 cut(s) 98, 321
TauI GCSGC 1 cut(s) 145
TfiI GAWTC 1 cut(s) 337
Tru1I TTAA 1 cut(s) 72
Tru9I TTAA 1 cut(s) 72
TscAI CASTG 3 cut(s) 133, 276, 283
TseI GCWGC 1 cut(s) 219
TspRI CASTG 3 cut(s) 133, 276, 283
Van91I CCANNNNNTGG 1 cut(s) 333
VpaK11BI GGWCC 1 cut(s) 233
XagI CCTNNNNNAGG 1 cut(s) 195
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.