pycom10g06850

Nudix hydrolase 3-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr10
Physical Location & Seq
Reverse (-)
8012544 .. 8013152
609 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom10g06850.1

Sequence Viewer

Length: 609 bp
ATGGCTAACCCATCTAACATTTGCTTAGATTTGAGTCTCAGCAGTGATACGGGTGCGCCGCGTGAGGGTAATGTCAGCAGTGATACCTGTAGTGGCCCTCTTACAGGTGAAGACTCCGTGATGAAGGATGCAACAACAGCTACAATAGTAGCTAGGAACCTCCTCACTCCTAGAGATAGTAGGCTGCTTTCAGGACGGTCCGATGAGTTGGCCGTTCAAGAGTCCCTAGCTCTCAGTGTTCAGTGTGCGGGCTCCGTGTCCAACATGGGCCAACGCCTACTTACTCGATCCCGTCAAGTTGAATCATTGATGGCGGAGGTGGAAAATCTTAAACAAGAGATCCAACAGCTTAAGCGCGAGAATAGAGGATTGCACGTGCTTGCAAATAATTATTCGACGAGCATGAAGAGGAAGCTTGATGAGCTGCAAGAATCTGAAGGTCGAATTCAAAGTGACCGTCACAGGCTTGCGGCTTTCTTCCAGAGGCACCTTTTTCCTGCGTCATCTAGCGTTCCACCAAGTATTGAGGCCTTGAATGATCTATCTTCGATGCCTCCCGCTCCTGGAGTTTTGCCAAGTAGTGGGGCTTCACATGAACAACCTTTGTGA

Protein Analysis

203

Amino Acids

21.81

Weight (kDa)

5.6

Isoelectric Point (pI)

59.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 486
AccB7I CCANNNNNTGG 1 cut(s) 581
AccBSI CCGCTC 1 cut(s) 560
AccII CGCG 2 cut(s) 61, 357
AciI CCGC 5 cut(s) 59, 248, 314, 470, 558
AclWI GGATC 2 cut(s) 282, 334
AcoI YGGCCR 1 cut(s) 210
AcsI RAATTY 1 cut(s) 444
AcuI CTGAAG 1 cut(s) 456
AcvI CACGTG 1 cut(s) 376
AfiI CCNNNNNNNGG 4 cut(s) 65, 104, 563, 581
AflII CTTAAG 1 cut(s) 350
AgsI TTSAA 4 cut(s) 218, 302, 449, 535
AjnI CCWGG 1 cut(s) 562
AluBI AGCT 6 cut(s) 140, 152, 230, 349, 415, 424
AluI AGCT 6 cut(s) 140, 152, 230, 349, 415, 424
Alw26I GTCTC 1 cut(s) 41
AlwI GGATC 2 cut(s) 282, 334
AoxI GGCC 4 cut(s) 94, 210, 268, 528
ApeKI GCWGC 2 cut(s) 184, 424
ApoI RAATTY 1 cut(s) 444
ArsI GACNNNNNNTTYG 2 cut(s) 442, 474
AspLEI GCGC 2 cut(s) 58, 357
AspS9I GGNCC 3 cut(s) 95, 198, 268
AsuHPI GGTGA 1 cut(s) 119
AvaII GGWCC 1 cut(s) 198
BanI GGYRCC 1 cut(s) 486
BanII GRGCYC 1 cut(s) 254
BarI GAAGNNNNNNTAC 2 cut(s) 571, 603
BbrPI CACGTG 1 cut(s) 376
BbsI GAAGAC 1 cut(s) 117
BbvI GCAGC 2 cut(s) 171, 411
BccI CCATC 2 cut(s) 19, 304
BceAI ACGGC 1 cut(s) 197
BciT130I CCWGG 1 cut(s) 564
BcoDI GTCTC 1 cut(s) 41
BfaI CTAG 4 cut(s) 153, 171, 227, 507
BfmI CTRYAG 1 cut(s) 88
BfrI CTTAAG 1 cut(s) 350
BisI GCNGC 4 cut(s) 59, 185, 425, 471
BlsI GCNGC 4 cut(s) 60, 186, 426, 472
Bme1390I CCNGG 1 cut(s) 564
Bme18I GGWCC 1 cut(s) 198
BmgT120I GGNCC 3 cut(s) 95, 198, 268
BmiI GGNNCC 3 cut(s) 158, 253, 488
BmrFI CCNGG 1 cut(s) 564
BmsI GCATC 2 cut(s) 118, 540
BpiI GAAGAC 1 cut(s) 117
BpmI CTGGAG 1 cut(s) 585
BsaAI YACGTR 1 cut(s) 376
Bsc4I CCNNNNNNNGG 4 cut(s) 65, 104, 563, 581
BseBI CCWGG 1 cut(s) 564
BseGI GGATG 1 cut(s) 133
BseLI CCNNNNNNNGG 4 cut(s) 65, 104, 563, 581
BseMII CTCAG 2 cut(s) 52, 247
BseRI GAGGAG 1 cut(s) 152
BseXI GCAGC 2 cut(s) 171, 411
Bsh1236I CGCG 2 cut(s) 61, 357
BshFI GGCC 4 cut(s) 96, 212, 270, 530
BshNI GGYRCC 1 cut(s) 486
BslFI GGGAC 1 cut(s) 208
BslI CCNNNNNNNGG 4 cut(s) 65, 104, 563, 581
BsmAI GTCTC 1 cut(s) 41
BsmFI GGGAC 1 cut(s) 208
BsnI GGCC 4 cut(s) 96, 212, 270, 530
Bsp1286I GDGCHC 1 cut(s) 254
Bsp143I GATC 3 cut(s) 287, 339, 538
BspACI CCGC 5 cut(s) 59, 248, 314, 470, 558
BspANI GGCC 4 cut(s) 96, 212, 270, 530
BspCNI CTCAG 2 cut(s) 51, 246
BspFNI CGCG 2 cut(s) 61, 357
BspLI GGNNCC 3 cut(s) 158, 253, 488
BspPI GGATC 2 cut(s) 282, 334
BspT107I GGYRCC 1 cut(s) 486
BspTI CTTAAG 1 cut(s) 350
BsrBI CCGCTC 1 cut(s) 560
BssMI GATC 3 cut(s) 287, 339, 538
Bst2UI CCWGG 1 cut(s) 564
Bst4CI ACNGT 2 cut(s) 198, 458
Bst6I CTCTTC 1 cut(s) 401
BstAFI CTTAAG 1 cut(s) 350
BstBAI YACGTR 1 cut(s) 376
BstC8I GCNNGC 3 cut(s) 250, 381, 468
BstDEI CTNAG 3 cut(s) 25, 38, 233
BstENI CCTNNNNNAGG 1 cut(s) 102
BstF5I GGATG 1 cut(s) 133
BstFNI CGCG 2 cut(s) 61, 357
BstHHI GCGC 2 cut(s) 58, 357
BstKTI GATC 3 cut(s) 290, 342, 541
BstMAI GTCTC 1 cut(s) 41
BstMBI GATC 3 cut(s) 287, 339, 538
BstMWI GCNNNNNNNGC 2 cut(s) 137, 421
BstNI CCWGG 1 cut(s) 564
BstSCI CCNGG 1 cut(s) 562
BstSFI CTRYAG 1 cut(s) 88
BstUI CGCG 2 cut(s) 61, 357
BstV1I GCAGC 2 cut(s) 171, 411
BstV2I GAAGAC 1 cut(s) 117
BstX2I RGATCY 1 cut(s) 339
BstYI RGATCY 1 cut(s) 339
BsuRI GGCC 4 cut(s) 96, 212, 270, 530
BtsCI GGATG 1 cut(s) 133
BtsI GCAGTG 2 cut(s) 49, 85
BtsIMutI CAGTG 4 cut(s) 49, 85, 241, 248
Cac8I GCNNGC 3 cut(s) 250, 381, 468
CfoI GCGC 2 cut(s) 58, 357
Cfr13I GGNCC 3 cut(s) 95, 198, 268
CpoI CGGWCCG 1 cut(s) 198
CseI GACGC 1 cut(s) 489
CspI CGGWCCG 1 cut(s) 198
CviAII CATG 3 cut(s) 265, 403, 593
DdeI CTNAG 3 cut(s) 25, 38, 233
DpnI GATC 3 cut(s) 289, 341, 540
DpnII GATC 3 cut(s) 287, 339, 538
EaeI YGGCCR 1 cut(s) 210
Eam1104I CTCTTC 1 cut(s) 401
EarI CTCTTC 1 cut(s) 401
EciI GGCGGA 1 cut(s) 329
Eco147I AGGCCT 1 cut(s) 530
Eco24I GRGCYC 1 cut(s) 254
Eco47I GGWCC 1 cut(s) 198
Eco57I CTGAAG 1 cut(s) 456
Eco72I CACGTG 1 cut(s) 376
EcoNI CCTNNNNNAGG 1 cut(s) 102
EcoRI GAATTC 1 cut(s) 444
EcoRII CCWGG 1 cut(s) 562
EcoT38I GRGCYC 1 cut(s) 254
FaeI CATG 3 cut(s) 268, 406, 596
FaiI YATR 3 cut(s) 266, 404, 594
FaqI GGGAC 1 cut(s) 208
FatI CATG 3 cut(s) 264, 402, 592
FauI CCCGC 2 cut(s) 241, 565
Fnu4HI GCNGC 4 cut(s) 59, 185, 425, 471
FokI GGATG 1 cut(s) 140
FriOI GRGCYC 1 cut(s) 254
Fsp4HI GCNGC 4 cut(s) 59, 185, 425, 471
FspBI CTAG 4 cut(s) 153, 171, 227, 507
GlaI GCGC 2 cut(s) 57, 356
GluI GCNGC 4 cut(s) 59, 185, 425, 471
GsuI CTGGAG 1 cut(s) 585
HaeIII GGCC 4 cut(s) 96, 212, 270, 530
HgaI GACGC 1 cut(s) 489
HhaI GCGC 2 cut(s) 58, 357
Hin1II CATG 3 cut(s) 268, 406, 596
Hin6I GCGC 2 cut(s) 56, 355
HinP1I GCGC 2 cut(s) 56, 355
HindIII AAGCTT 1 cut(s) 413
HinfI GANTC 5 cut(s) 34, 113, 221, 302, 431
HphI GGTGA 1 cut(s) 119
Hpy188I TCNGA 2 cut(s) 202, 436
Hpy188III TCNNGA 3 cut(s) 192, 218, 481
Hpy99I CGWCG 1 cut(s) 400
HpyAV CCTTC 2 cut(s) 118, 431
HpyCH4III ACNGT 2 cut(s) 198, 458
HpyCH4IV ACGT 1 cut(s) 375
HpyCH4V TGCA 4 cut(s) 131, 373, 383, 427
HpyF10VI GCNNNNNNNGC 2 cut(s) 137, 421
HpyF3I CTNAG 3 cut(s) 25, 38, 233
HpySE526I ACGT 1 cut(s) 375
Hsp92II CATG 3 cut(s) 268, 406, 596
HspAI GCGC 2 cut(s) 56, 355
Kzo9I GATC 3 cut(s) 287, 339, 538
LmnI GCTCC 2 cut(s) 257, 565
LpnPI CCDG 8 cut(s) 90, 100, 177, 448, 494, 510, 549, 576
Lsp1109I GCAGC 2 cut(s) 171, 411
LweI GCATC 2 cut(s) 118, 540
MaeI CTAG 4 cut(s) 153, 171, 227, 507
MaeII ACGT 1 cut(s) 375
MaeIII GTNAC 2 cut(s) 452, 458
MalI GATC 3 cut(s) 289, 341, 540
MbiI CCGCTC 1 cut(s) 560
MboI GATC 3 cut(s) 287, 339, 538
MboII GAAGA 4 cut(s) 122, 418, 469, 537
MflI RGATCY 1 cut(s) 339
MhlI GDGCHC 1 cut(s) 254
MluCI AATT 2 cut(s) 388, 444
MlyI GAGTC 3 cut(s) 43, 107, 230
MmeI TCCRAC 2 cut(s) 285, 367
MseI TTAA 2 cut(s) 330, 351
MspCI CTTAAG 1 cut(s) 350
MspR9I CCNGG 1 cut(s) 564
MvaI CCWGG 1 cut(s) 564
MvnI CGCG 2 cut(s) 61, 357
MwoI GCNNNNNNNGC 2 cut(s) 137, 421
NdeII GATC 3 cut(s) 287, 339, 538
NlaIII CATG 3 cut(s) 268, 406, 596
NlaIV GGNNCC 3 cut(s) 158, 253, 488
NmuCI GTSAC 2 cut(s) 452, 458
PceI AGGCCT 1 cut(s) 530
PfeI GAWTC 2 cut(s) 302, 431
PflMI CCANNNNNTGG 1 cut(s) 581
PfoI TCCNGGA 1 cut(s) 562
PkrI GCNGC 4 cut(s) 60, 186, 426, 472
PleI GAGTC 3 cut(s) 42, 107, 229
PmaCI CACGTG 1 cut(s) 376
PmlI CACGTG 1 cut(s) 376
PpsI GAGTC 3 cut(s) 42, 107, 229
Ppu21I YACGTR 1 cut(s) 376
Psp6I CCWGG 1 cut(s) 562
PspCI CACGTG 1 cut(s) 376
PspGI CCWGG 1 cut(s) 562
PspN4I GGNNCC 3 cut(s) 158, 253, 488
PspPI GGNCC 3 cut(s) 95, 198, 268
PsuI RGATCY 1 cut(s) 339
Rsr2I CGGWCCG 1 cut(s) 198
RsrII CGGWCCG 1 cut(s) 198
SaqAI TTAA 2 cut(s) 330, 351
SatI GCNGC 4 cut(s) 59, 185, 425, 471
Sau3AI GATC 3 cut(s) 287, 339, 538
Sau96I GGNCC 3 cut(s) 95, 198, 268
SchI GAGTC 3 cut(s) 43, 107, 230
ScrFI CCNGG 1 cut(s) 564
SduI GDGCHC 1 cut(s) 254
SfaNI GCATC 2 cut(s) 118, 540
SfcI CTRYAG 1 cut(s) 88
SinI GGWCC 1 cut(s) 198
SmlI CTYRAG 1 cut(s) 350
SmoI CTYRAG 1 cut(s) 350
Sse9I AATT 2 cut(s) 388, 444
SseBI AGGCCT 1 cut(s) 530
SsiI CCGC 5 cut(s) 59, 248, 314, 470, 558
SspMI CTAG 4 cut(s) 153, 171, 227, 507
StuI AGGCCT 1 cut(s) 530
StyD4I CCNGG 1 cut(s) 562
TaaI ACNGT 2 cut(s) 198, 458
TaiI ACGT 1 cut(s) 378
TaqI TCGA 4 cut(s) 286, 395, 442, 548
TasI AATT 2 cut(s) 388, 444
TauI GCSGC 2 cut(s) 61, 473
TfiI GAWTC 2 cut(s) 302, 431
Tru1I TTAA 2 cut(s) 330, 351
Tru9I TTAA 2 cut(s) 330, 351
TscAI CASTG 4 cut(s) 49, 85, 241, 248
TseFI GTSAC 2 cut(s) 452, 458
TseI GCWGC 2 cut(s) 184, 424
Tsp45I GTSAC 2 cut(s) 452, 458
TspDTI ATGAA 3 cut(s) 137, 419, 609
TspGWI ACGGA 2 cut(s) 106, 244
TspRI CASTG 4 cut(s) 49, 85, 241, 248
Van91I CCANNNNNTGG 1 cut(s) 581
Vha464I CTTAAG 1 cut(s) 350
VpaK11BI GGWCC 1 cut(s) 198
XagI CCTNNNNNAGG 1 cut(s) 102
XapI RAATTY 1 cut(s) 444
XspI CTAG 4 cut(s) 153, 171, 227, 507
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.