pycom13g26350

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
Physical Location & Seq
Forward (+)
23018002 .. 23019266
1265 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom13g26350.4

Sequence Viewer

Length: 822 bp
ATGATGCTGCAGGGGAAGGCGTCGTGCTCCAGCAGTTTGTTCCACCGAGGTGGTGCGCAACCCTTTGCCTTTAAATGGTCTTTCAAGGCATCACTTCTCAGCAATTCACCTATGCTTGGCAGCTTCAGTGTAAAGAGCCGACACTCCGTCGCTTGTCCTGAAGCTGTTGGAAATTTTAAATGTAAAGGGCAAAGATTATTGTTTGAGCCGTCTCATATAAATGTTATATGCTTAAATGATAAGTCCAAGGAATACGTGATTGGAAGAATGCGATCTAAAGAAGTTAGATTCATGAGACCATTCTTTCATCAGTACGTGCTATGTCTTCTCTCAGGGAGAGTGACTAGTCTCAAGTCATTGGTGTGTGTGACATCAAGACAAGTACGTAGGTGCTCAATAGAGAATGAGTTCACTGAACACGATCAACGAAGAGTTCTCATATTCATGTCACATGAGAACTCATGTTGTCTTGTGGTTAGGTCCTTAATCTTTGATTATGTCAAAGTCACTCCATCAGGAGGGTGTCCACGGCGCAACAAGGGATCTCTAACCTTCAAACTGAAGATTTGTGAAAAACAAGTTCATTTGAGCAACATCAACAACATGCAATTAACAATTAGAAGGCGGAATCATGTTTATATAGGTGAACCAAAACTCAACTCAAAACAAAGTGAGGAAATCTATGAGATTCATGTGGGATTTCTAATGACTAGCATGCATATACAATTCAAAATTTATATACGAAAGCAACGGAAGCATGTCATACATTTTATCAAAGCTATAGTCATGCAAATCCCCTTCAAGATGCATAGGTTTATATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

274

Amino Acids

31.71

Weight (kDa)

10.15

Isoelectric Point (pI)

55.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 57
AciI CCGC 1 cut(s) 625
AclWI GGATC 1 cut(s) 550
AcsI RAATTY 2 cut(s) 172, 732
AcuI CTGAAG 3 cut(s) 109, 180, 581
AcyI GRCGYC 1 cut(s) 20
AfaI GTAC 2 cut(s) 314, 384
AfiI CCNNNNNNNGG 3 cut(s) 75, 116, 518
AgsI TTSAA 4 cut(s) 85, 556, 730, 802
AhdI GACNNNNNGTC 1 cut(s) 146
AhlI ACTAGT 1 cut(s) 344
AjuI GAANNNNNNNTTGG 2 cut(s) 243, 275
AleI CACNNNNGTG 1 cut(s) 48
AluBI AGCT 3 cut(s) 123, 164, 779
AluI AGCT 3 cut(s) 123, 164, 779
Alw21I GWGCWC 2 cut(s) 29, 395
Alw26I GTCTC 3 cut(s) 216, 289, 353
AlwI GGATC 1 cut(s) 550
ApeKI GCWGC 2 cut(s) 7, 120
ApoI RAATTY 2 cut(s) 172, 732
ArsI GACNNNNNNTTYG 2 cut(s) 768, 800
Asp700I GAANNNNTTC 1 cut(s) 407
AspLEI GCGC 2 cut(s) 58, 534
AspS9I GGNCC 1 cut(s) 480
AsuHPI GGTGA 2 cut(s) 99, 656
AvaII GGWCC 1 cut(s) 480
BbsI GAAGAC 1 cut(s) 317
Bbv12I GWGCWC 2 cut(s) 29, 395
BbvI GCAGC 1 cut(s) 132
BccI CCATC 1 cut(s) 520
BceAI ACGGC 2 cut(s) 193, 545
BcoDI GTCTC 3 cut(s) 216, 289, 353
BcuI ACTAGT 1 cut(s) 344
BfaI CTAG 2 cut(s) 345, 711
BfmI CTRYAG 2 cut(s) 8, 780
BisI GCNGC 2 cut(s) 8, 121
BlsI GCNGC 2 cut(s) 9, 122
Bme18I GGWCC 1 cut(s) 480
BmeRI GACNNNNNGTC 1 cut(s) 146
BmgT120I GGNCC 1 cut(s) 480
BmsI GCATC 2 cut(s) 98, 795
BpiI GAAGAC 1 cut(s) 317
BpmI CTGGAG 1 cut(s) 13
BpuEI CTTGAG 1 cut(s) 335
BsaAI YACGTR 3 cut(s) 256, 316, 386
BsaHI GRCGYC 1 cut(s) 20
BsaI GGTCTC 1 cut(s) 289
BsaJI CCNNGG 3 cut(s) 46, 246, 527
Bsc4I CCNNNNNNNGG 3 cut(s) 75, 116, 518
BseDI CCNNGG 3 cut(s) 46, 246, 527
BseLI CCNNNNNNNGG 3 cut(s) 75, 116, 518
BseMII CTCAG 2 cut(s) 112, 345
BseXI GCAGC 1 cut(s) 132
BsiHKAI GWGCWC 2 cut(s) 29, 395
BslI CCNNNNNNNGG 3 cut(s) 75, 116, 518
BsmAI GTCTC 3 cut(s) 216, 289, 353
BsmBI CGTCTC 1 cut(s) 216
BsmI GAATGC 1 cut(s) 273
Bso31I GGTCTC 1 cut(s) 289
Bsp1286I GDGCHC 2 cut(s) 29, 395
Bsp143I GATC 3 cut(s) 272, 421, 542
BspACI CCGC 1 cut(s) 625
BspCNI CTCAG 2 cut(s) 111, 344
BspHI TCATGA 1 cut(s) 291
BspMAI CTGCAG 1 cut(s) 12
BspPI GGATC 1 cut(s) 550
BspTNI GGTCTC 1 cut(s) 289
BssECI CCNNGG 3 cut(s) 46, 246, 527
BssMI GATC 3 cut(s) 272, 421, 542
BssNI GRCGYC 1 cut(s) 20
BssT1I CCWWGG 1 cut(s) 246
Bst6I CTCTTC 1 cut(s) 424
BstACI GRCGYC 1 cut(s) 20
BstBAI YACGTR 3 cut(s) 256, 316, 386
BstC8I GCNNGC 1 cut(s) 716
BstDEI CTNAG 2 cut(s) 98, 331
BstDSI CCRYGG 1 cut(s) 527
BstHHI GCGC 2 cut(s) 58, 534
BstKTI GATC 3 cut(s) 275, 424, 545
BstMAI GTCTC 3 cut(s) 216, 289, 353
BstMBI GATC 3 cut(s) 272, 421, 542
BstMWI GCNNNNNNNGC 1 cut(s) 754
BstNSI RCATGY 3 cut(s) 607, 718, 761
BstSFI CTRYAG 2 cut(s) 8, 780
BstSNI TACGTA 1 cut(s) 386
BstV1I GCAGC 1 cut(s) 132
BstV2I GAAGAC 1 cut(s) 317
BstX2I RGATCY 1 cut(s) 542
BstXI CCANNNNNNTGG 1 cut(s) 50
BstYI RGATCY 1 cut(s) 542
BtgI CCRYGG 1 cut(s) 527
BtsIMutI CAGTG 2 cut(s) 133, 411
Cac8I GCNNGC 1 cut(s) 716
CciI TCATGA 1 cut(s) 291
CfoI GCGC 2 cut(s) 58, 534
Cfr13I GGNCC 1 cut(s) 480
CseI GACGC 1 cut(s) 9
Csp6I GTAC 2 cut(s) 313, 383
CviJI RGCY 5 cut(s) 123, 138, 164, 208, 779
CviKI_1 RGCY 5 cut(s) 123, 138, 164, 208, 779
CviQI GTAC 2 cut(s) 313, 383
DdeI CTNAG 2 cut(s) 98, 331
DpnI GATC 3 cut(s) 274, 423, 544
DpnII GATC 3 cut(s) 272, 421, 542
DraI TTTAAA 2 cut(s) 73, 178
DriI GACNNNNNGTC 1 cut(s) 146
Eam1104I CTCTTC 1 cut(s) 424
Eam1105I GACNNNNNGTC 1 cut(s) 146
EarI CTCTTC 1 cut(s) 424
EciI GGCGGA 1 cut(s) 640
Eco105I TACGTA 1 cut(s) 386
Eco130I CCWWGG 1 cut(s) 246
Eco31I GGTCTC 1 cut(s) 289
Eco47I GGWCC 1 cut(s) 480
Eco57I CTGAAG 3 cut(s) 109, 180, 581
EcoO109I RGGNCCY 1 cut(s) 480
EcoT14I CCWWGG 1 cut(s) 246
EcoT22I ATGCAT 2 cut(s) 720, 810
ErhI CCWWGG 1 cut(s) 246
Esp3I CGTCTC 1 cut(s) 216
Fnu4HI GCNGC 2 cut(s) 8, 121
Fsp4HI GCNGC 2 cut(s) 8, 121
FspBI CTAG 2 cut(s) 345, 711
FspI TGCGCA 1 cut(s) 57
GlaI GCGC 2 cut(s) 57, 533
GluI GCNGC 2 cut(s) 8, 121
GsuI CTGGAG 1 cut(s) 13
HgaI GACGC 1 cut(s) 9
HhaI GCGC 2 cut(s) 58, 534
Hin1I GRCGYC 1 cut(s) 20
Hin6I GCGC 2 cut(s) 56, 532
HinP1I GCGC 2 cut(s) 56, 532
HinfI GANTC 3 cut(s) 288, 628, 688
HphI GGTGA 2 cut(s) 99, 656
Hpy166II GTNNAC 3 cut(s) 411, 527, 647
Hpy188III TCNNGA 5 cut(s) 158, 292, 375, 516, 802
Hpy8I GTNNAC 3 cut(s) 411, 527, 647
Hpy99I CGWCG 2 cut(s) 25, 152
HpyAV CCTTC 4 cut(s) 10, 562, 615, 808
HpyCH4IV ACGT 3 cut(s) 255, 315, 385
HpyCH4V TGCA 5 cut(s) 10, 607, 718, 790, 808
HpyF10VI GCNNNNNNNGC 1 cut(s) 754
HpyF3I CTNAG 2 cut(s) 98, 331
HpySE526I ACGT 3 cut(s) 255, 315, 385
Hsp92I GRCGYC 1 cut(s) 20
HspAI GCGC 2 cut(s) 56, 532
Kzo9I GATC 3 cut(s) 272, 421, 542
LmnI GCTCC 1 cut(s) 32
LpnPI CCDG 4 cut(s) 43, 171, 318, 501
Lsp1109I GCAGC 1 cut(s) 132
LweI GCATC 2 cut(s) 98, 795
MaeI CTAG 2 cut(s) 345, 711
MaeII ACGT 3 cut(s) 255, 315, 385
MaeIII GTNAC 4 cut(s) 340, 367, 447, 505
MalI GATC 3 cut(s) 274, 423, 544
MboI GATC 3 cut(s) 272, 421, 542
MboII GAAGA 4 cut(s) 276, 317, 441, 574
MflI RGATCY 1 cut(s) 542
MhlI GDGCHC 2 cut(s) 29, 395
MluCI AATT 6 cut(s) 103, 172, 608, 615, 725, 732
MmeI TCCRAC 1 cut(s) 148
MnlI CCTC 3 cut(s) 41, 512, 667
Mph1103I ATGCAT 2 cut(s) 720, 810
MroXI GAANNNNTTC 1 cut(s) 407
MseI TTAA 5 cut(s) 72, 177, 233, 485, 611
MslI CAYNNNNRTG 4 cut(s) 48, 219, 361, 443
Mva1269I GAATGC 1 cut(s) 273
MwoI GCNNNNNNNGC 1 cut(s) 754
NdeII GATC 3 cut(s) 272, 421, 542
NmuCI GTSAC 4 cut(s) 340, 367, 447, 505
NsbI TGCGCA 1 cut(s) 57
NsiI ATGCAT 2 cut(s) 720, 810
NspI RCATGY 3 cut(s) 607, 718, 761
OliI CACNNNNGTG 1 cut(s) 48
PaeI GCATGC 1 cut(s) 718
PagI TCATGA 1 cut(s) 291
PctI GAATGC 1 cut(s) 273
PdmI GAANNNNTTC 1 cut(s) 407
PfeI GAWTC 3 cut(s) 288, 628, 688
PkrI GCNGC 2 cut(s) 9, 122
Ppu21I YACGTR 3 cut(s) 256, 316, 386
PpuMI RGGWCCY 1 cut(s) 480
Psp5II RGGWCCY 1 cut(s) 480
PspPI GGNCC 1 cut(s) 480
PspPPI RGGWCCY 1 cut(s) 480
PstI CTGCAG 1 cut(s) 12
PsuI RGATCY 1 cut(s) 542
RsaI GTAC 2 cut(s) 314, 384
RsaNI GTAC 2 cut(s) 313, 383
RseI CAYNNNNRTG 4 cut(s) 48, 219, 361, 443
SaqAI TTAA 5 cut(s) 72, 177, 233, 485, 611
SatI GCNGC 2 cut(s) 8, 121
Sau3AI GATC 3 cut(s) 272, 421, 542
Sau96I GGNCC 1 cut(s) 480
SduI GDGCHC 2 cut(s) 29, 395
SfaNI GCATC 2 cut(s) 98, 795
SfcI CTRYAG 2 cut(s) 8, 780
SinI GGWCC 1 cut(s) 480
SmiMI CAYNNNNRTG 4 cut(s) 48, 219, 361, 443
SmlI CTYRAG 1 cut(s) 350
SmoI CTYRAG 1 cut(s) 350
SnaBI TACGTA 1 cut(s) 386
SpeI ACTAGT 1 cut(s) 344
SphI GCATGC 1 cut(s) 718
Sse9I AATT 6 cut(s) 103, 172, 608, 615, 725, 732
SsiI CCGC 1 cut(s) 625
SspMI CTAG 2 cut(s) 345, 711
StyI CCWWGG 1 cut(s) 246
TaiI ACGT 3 cut(s) 258, 318, 388
TasI AATT 6 cut(s) 103, 172, 608, 615, 725, 732
TfiI GAWTC 3 cut(s) 288, 628, 688
Tru1I TTAA 5 cut(s) 72, 177, 233, 485, 611
Tru9I TTAA 5 cut(s) 72, 177, 233, 485, 611
TscAI CASTG 2 cut(s) 133, 418
TseFI GTSAC 4 cut(s) 340, 367, 447, 505
TseI GCWGC 2 cut(s) 7, 120
Tsp45I GTSAC 4 cut(s) 340, 367, 447, 505
TspDTI ATGAA 5 cut(s) 280, 296, 433, 572, 680
TspGWI ACGGA 2 cut(s) 136, 766
TspRI CASTG 2 cut(s) 133, 418
VpaK11BI GGWCC 1 cut(s) 480
XapI RAATTY 2 cut(s) 172, 732
XceI RCATGY 3 cut(s) 607, 718, 761
XmnI GAANNNNTTC 1 cut(s) 407
XspI CTAG 2 cut(s) 345, 711
Zsp2I ATGCAT 2 cut(s) 720, 810
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.