pycom13g28140

Belongs to the peptidase A1 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
OG0000120
Physical Location & Seq
Forward (+)
24110983 .. 24112083
1101 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom13g28140.3

Sequence Viewer

Length: 822 bp
ATGAAGCTCTCTAAATTCACTTACTGTGTAGTCTCCCATAAATTTGACGATACCCCTGCAAAGCAGCGATCGTGTTCTGTACACCGGCAACAAAACGAAACAAAAGCTCAGAGCTTTATCTACATGTCGTTTCAGAAAAACCTAGGTCCTCCAAACTCTGCATTTCGCGAGTACTACTACATAATGCTAAAAAAAATCATCGTGGGCAAAAAGAATGTGAAGATTACGTACACGTTTCTTGTCCTCGGAGCCGACAGCAATGGCGGGACGATCGTGGATTTCGAATCGACCATCACGTTCATGAAGAAGCTGGTTTTTGAAGTCGTGGAGCAAGGGTTTGAGTCACAGATGGAAAATTACATGAGAGCAAAGGATTTGGAAACCAAAACGGGATTGAGATCGATCATACCAGTAACCGTTTTGTTTCTGTTGGAAATGTGCCCTAAAACCAATCATATGATGATACTTTATGGACATTTCACATCCGTCTCATATAAATGTTATATTCATGAGACCATTCTTTCATTGACACATCCTAAACATCAGTACGTGCTATGTCTTCTCTCAGGGAGAGTGACTAGTCTCGAGTCATTGGTGTGTGTGACATCAAGACAAGTACATAGGTGCTCAATAGAGAATGAGTTCACTGAACACGATCAACGAAGAGTTCTCATATTCATGTCACATGAGAACTCATGTTGTCTTGTGGTTAGGTCCTTAATCTTTGATTATGTCAAAGTCACTCCATCAGGAGGGTGTCCACGGCGCAACAAGGGATCTCTAACCTTCAAACTGTTTGAGGGAGAATACTCTATGATATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04138 map04138
Pfam Domains
Protein Families
TAXi_C TAXi_N

Protein Analysis

274

Amino Acids

31.51

Weight (kDa)

9.07

Isoelectric Point (pI)

41.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 168
AciI CCGC 1 cut(s) 264
AclWI GGATC 1 cut(s) 784
AcsI RAATTY 2 cut(s) 14, 41
AfaI GTAC 5 cut(s) 81, 173, 230, 548, 618
AfiI CCNNNNNNNGG 1 cut(s) 752
AflIII ACRYGT 2 cut(s) 123, 231
AgsI TTSAA 2 cut(s) 320, 790
AhlI ACTAGT 1 cut(s) 578
AluBI AGCT 4 cut(s) 7, 107, 114, 310
AluI AGCT 4 cut(s) 7, 107, 114, 310
Alw21I GWGCWC 1 cut(s) 629
Alw26I GTCTC 4 cut(s) 37, 493, 506, 587
AlwI GGATC 1 cut(s) 784
Ama87I CYCGRG 1 cut(s) 584
ApeKI GCWGC 1 cut(s) 64
ApoI RAATTY 2 cut(s) 14, 41
Asp700I GAANNNNTTC 1 cut(s) 641
AspA2I CCTAGG 1 cut(s) 142
AspLEI GCGC 1 cut(s) 768
AspS9I GGNCC 2 cut(s) 146, 714
AsuII TTCGAA 1 cut(s) 282
AvaI CYCGRG 1 cut(s) 584
AvaII GGWCC 2 cut(s) 146, 714
AvrII CCTAGG 1 cut(s) 142
BaeGI GKGCMC 1 cut(s) 443
BarI GAAGNNNNNNTAC 2 cut(s) 212, 244
BbsI GAAGAC 1 cut(s) 551
Bbv12I GWGCWC 1 cut(s) 629
BbvI GCAGC 1 cut(s) 76
BccI CCATC 3 cut(s) 299, 343, 754
BceAI ACGGC 1 cut(s) 779
BcgI CGANNNNNNTGC 2 cut(s) 38, 72
BcoDI GTCTC 4 cut(s) 37, 493, 506, 587
BcuI ACTAGT 1 cut(s) 578
BfaI CTAG 2 cut(s) 143, 579
BisI GCNGC 1 cut(s) 65
BlnI CCTAGG 1 cut(s) 142
BlsI GCNGC 1 cut(s) 66
BmcAI AGTACT 1 cut(s) 173
Bme18I GGWCC 2 cut(s) 146, 714
BmeT110I CYCGRG 1 cut(s) 584
BmgT120I GGNCC 2 cut(s) 146, 714
BmiI GGNNCC 1 cut(s) 250
BpiI GAAGAC 1 cut(s) 551
Bpu14I TTCGAA 1 cut(s) 282
Bsa29I ATCGAT 1 cut(s) 401
BsaAI YACGTR 2 cut(s) 228, 550
BsaBI GATNNNNATC 1 cut(s) 397
BsaI GGTCTC 1 cut(s) 506
BsaJI CCNNGG 3 cut(s) 142, 244, 761
BsaXI ACNNNNNCTCC 2 cut(s) 320, 350
Bsc4I CCNNNNNNNGG 1 cut(s) 752
Bse118I RCCGGY 1 cut(s) 84
Bse1I ACTGG 1 cut(s) 410
Bse3DI GCAATG 1 cut(s) 265
Bse8I GATNNNNATC 1 cut(s) 397
BseCI ATCGAT 1 cut(s) 401
BseDI CCNNGG 3 cut(s) 142, 244, 761
BseGI GGATG 2 cut(s) 482, 532
BseJI GATNNNNATC 1 cut(s) 397
BseLI CCNNNNNNNGG 1 cut(s) 752
BseMI GCAATG 1 cut(s) 265
BseMII CTCAG 2 cut(s) 122, 579
BseNI ACTGG 1 cut(s) 410
BseSI GKGCMC 1 cut(s) 443
BseXI GCAGC 1 cut(s) 76
Bsh1236I CGCG 1 cut(s) 168
Bsh1285I CGRYCG 2 cut(s) 71, 273
BshVI ATCGAT 1 cut(s) 401
BsiEI CGRYCG 2 cut(s) 71, 273
BsiHKAI GWGCWC 1 cut(s) 629
BsiHKCI CYCGRG 1 cut(s) 584
BsiSI CCGG 1 cut(s) 85
BslFI GGGAC 1 cut(s) 280
BslI CCNNNNNNNGG 1 cut(s) 752
BsmAI GTCTC 4 cut(s) 37, 493, 506, 587
BsmBI CGTCTC 1 cut(s) 493
BsmFI GGGAC 1 cut(s) 280
Bso31I GGTCTC 1 cut(s) 506
BsoBI CYCGRG 1 cut(s) 584
Bsp119I TTCGAA 1 cut(s) 282
Bsp1286I GDGCHC 2 cut(s) 443, 629
Bsp1407I TGTACA 1 cut(s) 79
Bsp143I GATC 6 cut(s) 68, 270, 398, 402, 655, 776
Bsp68I TCGCGA 1 cut(s) 168
BspACI CCGC 1 cut(s) 264
BspCNI CTCAG 2 cut(s) 121, 578
BspDI ATCGAT 1 cut(s) 401
BspFNI CGCG 1 cut(s) 168
BspHI TCATGA 2 cut(s) 300, 508
BspLI GGNNCC 1 cut(s) 250
BspPI GGATC 1 cut(s) 784
BspT104I TTCGAA 1 cut(s) 282
BspTNI GGTCTC 1 cut(s) 506
BsrDI GCAATG 1 cut(s) 265
BsrFI RCCGGY 1 cut(s) 84
BsrGI TGTACA 1 cut(s) 79
BsrI ACTGG 1 cut(s) 410
BssAI RCCGGY 1 cut(s) 84
BssECI CCNNGG 3 cut(s) 142, 244, 761
BssMI GATC 6 cut(s) 68, 270, 398, 402, 655, 776
BssT1I CCWWGG 1 cut(s) 142
Bst4CI ACNGT 3 cut(s) 26, 418, 795
Bst6I CTCTTC 1 cut(s) 658
BstAUI TGTACA 1 cut(s) 79
BstBAI YACGTR 2 cut(s) 228, 550
BstBI TTCGAA 1 cut(s) 282
BstDEI CTNAG 2 cut(s) 108, 565
BstDSI CCRYGG 1 cut(s) 761
BstF5I GGATG 2 cut(s) 482, 532
BstFNI CGCG 1 cut(s) 168
BstHHI GCGC 1 cut(s) 768
BstKTI GATC 6 cut(s) 71, 273, 401, 405, 658, 779
BstMAI GTCTC 4 cut(s) 37, 493, 506, 587
BstMBI GATC 6 cut(s) 68, 270, 398, 402, 655, 776
BstMCI CGRYCG 2 cut(s) 71, 273
BstNSI RCATGY 1 cut(s) 127
BstSLI GKGCMC 1 cut(s) 443
BstSNI TACGTA 1 cut(s) 228
BstUI CGCG 1 cut(s) 168
BstV1I GCAGC 1 cut(s) 76
BstV2I GAAGAC 1 cut(s) 551
BstX2I RGATCY 1 cut(s) 776
BstYI RGATCY 1 cut(s) 776
Bsu15I ATCGAT 1 cut(s) 401
BsuTUI ATCGAT 1 cut(s) 401
BtgI CCRYGG 1 cut(s) 761
BtsCI GGATG 2 cut(s) 482, 532
BtsIMutI CAGTG 1 cut(s) 645
BtuMI TCGCGA 1 cut(s) 168
CciI TCATGA 2 cut(s) 300, 508
CfoI GCGC 1 cut(s) 768
Cfr10I RCCGGY 1 cut(s) 84
Cfr13I GGNCC 2 cut(s) 146, 714
ClaI ATCGAT 1 cut(s) 401
Csp6I GTAC 5 cut(s) 80, 172, 229, 547, 617
CviAII CATG 7 cut(s) 124, 301, 361, 509, 679, 686, 696
CviJI RGCY 5 cut(s) 7, 107, 114, 251, 310
CviKI_1 RGCY 5 cut(s) 7, 107, 114, 251, 310
CviQI GTAC 5 cut(s) 80, 172, 229, 547, 617
DdeI CTNAG 2 cut(s) 108, 565
DpnI GATC 6 cut(s) 70, 272, 400, 404, 657, 778
DpnII GATC 6 cut(s) 68, 270, 398, 402, 655, 776
Eam1104I CTCTTC 1 cut(s) 658
EarI CTCTTC 1 cut(s) 658
Eco105I TACGTA 1 cut(s) 228
Eco130I CCWWGG 1 cut(s) 142
Eco31I GGTCTC 1 cut(s) 506
Eco47I GGWCC 2 cut(s) 146, 714
Eco88I CYCGRG 1 cut(s) 584
EcoO109I RGGNCCY 2 cut(s) 146, 714
EcoT14I CCWWGG 1 cut(s) 142
ErhI CCWWGG 1 cut(s) 142
Esp3I CGTCTC 1 cut(s) 493
FaeI CATG 7 cut(s) 127, 304, 364, 512, 682, 689, 699
FaqI GGGAC 1 cut(s) 280
FatI CATG 7 cut(s) 123, 300, 360, 508, 678, 685, 695
FauI CCCGC 1 cut(s) 257
FauNDI CATATG 1 cut(s) 456
Fnu4HI GCNGC 1 cut(s) 65
FokI GGATG 2 cut(s) 469, 519
Fsp4HI GCNGC 1 cut(s) 65
FspBI CTAG 2 cut(s) 143, 579
GlaI GCGC 1 cut(s) 767
GluI GCNGC 1 cut(s) 65
HapII CCGG 1 cut(s) 85
HhaI GCGC 1 cut(s) 768
Hin1II CATG 7 cut(s) 127, 304, 364, 512, 682, 689, 699
Hin6I GCGC 1 cut(s) 766
HinP1I GCGC 1 cut(s) 766
HinfI GANTC 3 cut(s) 284, 341, 587
HpaII CCGG 1 cut(s) 85
Hpy166II GTNNAC 4 cut(s) 82, 231, 645, 761
Hpy188I TCNGA 3 cut(s) 111, 135, 248
Hpy188III TCNNGA 6 cut(s) 167, 301, 509, 584, 609, 750
Hpy8I GTNNAC 4 cut(s) 82, 231, 645, 761
HpyAV CCTTC 1 cut(s) 796
HpyCH4III ACNGT 3 cut(s) 26, 418, 795
HpyCH4IV ACGT 4 cut(s) 227, 233, 296, 549
HpyCH4V TGCA 2 cut(s) 59, 161
HpyF3I CTNAG 2 cut(s) 108, 565
HpySE526I ACGT 4 cut(s) 227, 233, 296, 549
Hsp92II CATG 7 cut(s) 127, 304, 364, 512, 682, 689, 699
HspAI GCGC 1 cut(s) 766
Kzo9I GATC 6 cut(s) 68, 270, 398, 402, 655, 776
LmnI GCTCC 2 cut(s) 248, 328
LpnPI CCDG 6 cut(s) 69, 98, 296, 423, 552, 735
Lsp1109I GCAGC 1 cut(s) 76
MaeI CTAG 2 cut(s) 143, 579
MaeII ACGT 4 cut(s) 227, 233, 296, 549
MaeIII GTNAC 6 cut(s) 342, 412, 574, 601, 681, 739
MalI GATC 6 cut(s) 70, 272, 400, 404, 657, 778
MboI GATC 6 cut(s) 68, 270, 398, 402, 655, 776
MboII GAAGA 4 cut(s) 232, 316, 551, 675
MflI RGATCY 1 cut(s) 776
MhlI GDGCHC 2 cut(s) 443, 629
MluCI AATT 3 cut(s) 14, 41, 355
MlyI GAGTC 2 cut(s) 350, 596
MmeI TCCRAC 1 cut(s) 411
MnlI CCTC 4 cut(s) 159, 254, 746, 793
MroXI GAANNNNTTC 1 cut(s) 641
MseI TTAA 1 cut(s) 719
MslI CAYNNNNRTG 4 cut(s) 299, 496, 595, 677
MspI CCGG 1 cut(s) 85
MvnI CGCG 1 cut(s) 168
NdeI CATATG 1 cut(s) 456
NdeII GATC 6 cut(s) 68, 270, 398, 402, 655, 776
NlaIII CATG 7 cut(s) 127, 304, 364, 512, 682, 689, 699
NlaIV GGNNCC 1 cut(s) 250
NmuCI GTSAC 5 cut(s) 342, 574, 601, 681, 739
NruI TCGCGA 1 cut(s) 168
NspI RCATGY 1 cut(s) 127
NspV TTCGAA 1 cut(s) 282
PaeR7I CTCGAG 1 cut(s) 584
PagI TCATGA 2 cut(s) 300, 508
PciI ACATGT 1 cut(s) 123
PcsI WCGNNNNNNNCGW 2 cut(s) 279, 293
PdmI GAANNNNTTC 1 cut(s) 641
PfeI GAWTC 1 cut(s) 284
PkrI GCNGC 1 cut(s) 66
Ple19I CGATCG 2 cut(s) 71, 273
PleI GAGTC 2 cut(s) 349, 595
PpsI GAGTC 2 cut(s) 349, 595
Ppu21I YACGTR 2 cut(s) 228, 550
PpuMI RGGWCCY 2 cut(s) 146, 714
PscI ACATGT 1 cut(s) 123
Psp5II RGGWCCY 2 cut(s) 146, 714
PspN4I GGNNCC 1 cut(s) 250
PspPI GGNCC 2 cut(s) 146, 714
PspPPI RGGWCCY 2 cut(s) 146, 714
PsuI RGATCY 1 cut(s) 776
PvuI CGATCG 2 cut(s) 71, 273
RruI TCGCGA 1 cut(s) 168
RsaI GTAC 5 cut(s) 81, 173, 230, 548, 618
RsaNI GTAC 5 cut(s) 80, 172, 229, 547, 617
RseI CAYNNNNRTG 4 cut(s) 299, 496, 595, 677
SaqAI TTAA 1 cut(s) 719
SatI GCNGC 1 cut(s) 65
Sau3AI GATC 6 cut(s) 68, 270, 398, 402, 655, 776
Sau96I GGNCC 2 cut(s) 146, 714
ScaI AGTACT 1 cut(s) 173
SchI GAGTC 2 cut(s) 350, 596
SduI GDGCHC 2 cut(s) 443, 629
Sfr274I CTCGAG 1 cut(s) 584
SfuI TTCGAA 1 cut(s) 282
SinI GGWCC 2 cut(s) 146, 714
SlaI CTCGAG 1 cut(s) 584
SmiMI CAYNNNNRTG 4 cut(s) 299, 496, 595, 677
SmlI CTYRAG 1 cut(s) 584
SmoI CTYRAG 1 cut(s) 584
SnaBI TACGTA 1 cut(s) 228
SpeI ACTAGT 1 cut(s) 578
Sse9I AATT 3 cut(s) 14, 41, 355
SsiI CCGC 1 cut(s) 264
SspMI CTAG 2 cut(s) 143, 579
StyI CCWWGG 1 cut(s) 142
TaaI ACNGT 3 cut(s) 26, 418, 795
TaiI ACGT 4 cut(s) 230, 236, 299, 552
TaqI TCGA 4 cut(s) 282, 287, 401, 585
TasI AATT 3 cut(s) 14, 41, 355
TatI WGTACW 3 cut(s) 79, 171, 616
TfiI GAWTC 1 cut(s) 284
Tru1I TTAA 1 cut(s) 719
Tru9I TTAA 1 cut(s) 719
TscAI CASTG 1 cut(s) 652
TseFI GTSAC 5 cut(s) 342, 574, 601, 681, 739
TseI GCWGC 1 cut(s) 64
Tsp45I GTSAC 5 cut(s) 342, 574, 601, 681, 739
TspDTI ATGAA 6 cut(s) 17, 289, 317, 497, 513, 667
TspGWI ACGGA 1 cut(s) 475
TspRI CASTG 1 cut(s) 652
VpaK11BI GGWCC 2 cut(s) 146, 714
XapI RAATTY 2 cut(s) 14, 41
XceI RCATGY 1 cut(s) 127
XhoI CTCGAG 1 cut(s) 584
XmaJI CCTAGG 1 cut(s) 142
XmnI GAANNNNTTC 1 cut(s) 641
XspI CTAG 2 cut(s) 143, 579
ZrmI AGTACT 1 cut(s) 173
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.