pycom520g00140

Chloroplast-localized elongation factor EF-G involved in protein synthesis in plastids. Catalyzes the GTP-dependent ribosomal translocation step during translation elongation. During this step, the ribosome changes from the pre-translocational (PRE) to the post-translocational (POST) state as the newly formed A- site-bound peptidyl-tRNA and P-site-bound deacylated tRNA move to the P and E sites, respectively. Catalyzes the coordinated movement of the two tRNA molecules, the mRNA and conformational changes in the ribosome

Basic Information

Type: gene
Biological Identity
pyrus_communis
SuperScaffold_520
Physical Location & Seq
Forward (+)
159431 .. 162877
3447 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom520g00140.20

Sequence Viewer

Length: 2361 bp
ATGTCGAATATGACTAAGTTCACCATAGTGATGACATGTAAGAATAGATCTTTCGTCCACAATCTATGTGCTTTTTTGGCACCACATAGACTTCCAACTCTTAGCATTTTGTCGGATCATTCAACTCCAAGAATCCGACAATCCACTTTGTACATAGCGTCAGTCAACTCAAATGATATCCTAAAACTGAGCTTTAAGAGAAGTAATAAGATCATCTTTTTTATCTTCATCATCTCAGGTATGATAATCTTATCACTAAATTTCATTCTAACTAGTCAGAGATACTCAACTTCTTTTGTAGTTGAGTCATACATGATAGACAAATCACAATGTCATATTTCTTCAGTATCTTTCAATATAAGTTCATCATCACTAGGAGACACCTCTTCAATAGAGTTAACAAAGTCAATGGCTTTCTCCTCATCATCTGATAACCTATCAGAACAAATAGATTCTTCACCCTTTTGGTTTCTTGTTGCTTATACTCTCAGCAGCCCGATGTCTAATACCACCACAAGAGAAACAAGGTCTAAGTTCACTAGTAGAAGGCTTGTCTCTACGATTGACAATTTCCTTGAATCTTTTCAAAACTCTCCAGCCTTTTTTACATCCCTTCCTTTGTTCTTGAGAGTCCTTATGAACTGTTTACCCAAAAAAGCTAGATTATCTTCAGATGATTCCTTGGTGACCATAGCTTCTTCAACACTGTTAAGGGTAACATCCTTCCTCCTTTTTAAATCTCCATGTCAAGTTCTATCTTATATAGAGAAAGACATCTTTGAAACCTTTCCAAAGGTGCAAGTTAATATCCCAATTCTTGGTACAATAAATCAAGTTCCAGAATGTGCTGAATTTTTTAAAGAGCATTGTACAACAAGAGGGATTCAAGAGAAAGAAGTTGCTAGGAAATATCGAGAATTCATCAAAGATGATGTTTTTGCGACAACCATCACCAGAGAAGTTGGATTTTATGACACAGGACAAATCACTGTCCTCACACCAAATCTGGCCGAGAGCAACATTCCTGAAACTTTCAAAGTAATGTTTGTCTTTGAGTTCTTGTCGCAGCACACAGGTAAGCTACCTCATCAAATTTCAATTTCGTTTTCTACTAACATGTTGTTGATTTCAATGATTCAAGCACCCACTCTAGAATTTAAACCATTACTGGATCGATCATTTCAAGTATCGCCTTTCATTCAAAGATCAACTCCATGCTTAAAGCGAGCACTTCTTGGGAGGCAACCCATGTATTCAAATAAAGAGACATTAGAATTTCCAGCTCCTACAACCAGATTTGCTCTCTTTTACCCTTCTCTTTATTTTTCTTTTGAGGACAATGTTTGGTTTAAGTGTGCGAGGGTAAACCGATTGCTTGTCATGACTTATCTTCGAATTTCACCACCTATCACTACTAATATTGTTATTCACTGTTTCAATGTGTTTTATTGTAAATACCAAAAAATAGTCGTTTTTGTTGCTTGTTTGTGTCTTAGGGTACCTTCTAACTATGAGGATTTGGTTTTTAATTGCATGACTGTTAAAGAAAGTTACAAACTTGTAGTTGCCATTGACGAGTTCACATGTAATCACAAAGAAAAAAAATCAATTTATGTAATGTGCTTGAAGAAACTTAAACTAACGCTACTACCCTATTCTTGTTTTCTAAAATCGTTGCATGATCGATCATTATTTCTTTGCTTGCTTAACTCATGCCCGTTTCATTCAAAGCATAAAATTGATTGCATAACAAATAACAAGATGAAGTTGTTTAGTTACCACCAGAGCCAAAAAGCCTTATCCCTTGCATATCTTGGATTATCCCTACCTAGCCTTAGTATAGGAATATCCATACCCTTGTTCTTAAAGAATAGTGAAAAAAATAAGTGTGGGGGAAGGATTTGTTCTTTTGAATCCGAGAATGAGTTCATAAGTGTTGGTTGCTTAAGAAGGGTCAAAAAATGTGAATCTGACCCTAAAGTTTACTTTGCTTACTATCACTTTAAGAACATTTACTTTTATCTTGATTGTTATGTGATTCAATATGTGGAGTTTGAAATTGGTACGAGCATATGGAATCTCTGGTTCTCCCTCCTAAGTAGTGGCATTCCTTTCATAAGATCGTGTACATTTCTAGTCTACATGTTTACATCAATTTTCTCACATATACTTAGTATAGGGAGTGTAGTCAGAAAATTTTCTCTGAGGCATGTTTTTACTTCTAAATGTTTAAGTATAAGCTCAAGAGTAATTGTTGGAAGGTTTAGGTTATGTTTTGTTTTCTTTGTTTTAGGAGTATATTTATGTGACTTTGTTATCTTATTTCTTTGCATTTATTTAGTTAATTTCTGTTTATTGTAG

Protein Analysis

787

Amino Acids

90.35

Weight (kDa)

9.18

Isoelectric Point (pI)

50.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 1498
AccB1I GGYRCC 2 cut(s) 79, 1498
AccB7I CCANNNNNTGG 1 cut(s) 818
AccI GTMKAC 1 cut(s) 2139
AclWI GGATC 2 cut(s) 123, 1179
AcoI YGGCCR 1 cut(s) 1008
AcsI RAATTY 8 cut(s) 259, 851, 917, 1092, 1154, 1274, 1395, 2195
AcuI CTGAAG 2 cut(s) 327, 654
AfaI GTAC 6 cut(s) 152, 823, 871, 1500, 2065, 2128
AfiI CCNNNNNNNGG 1 cut(s) 818
AflII CTTAAG 1 cut(s) 1945
AflIII ACRYGT 4 cut(s) 35, 1116, 1583, 2142
AhlI ACTAGT 2 cut(s) 272, 539
AleI CACNNNNGTG 1 cut(s) 26
AluBI AGCT 6 cut(s) 192, 659, 695, 1081, 1283, 2241
AluI AGCT 6 cut(s) 192, 659, 695, 1081, 1283, 2241
Alw21I GWGCWC 1 cut(s) 1231
Alw26I GTCTC 3 cut(s) 372, 559, 1259
AlwI GGATC 2 cut(s) 123, 1179
AoxI GGCC 1 cut(s) 1008
ApeKI GCWGC 2 cut(s) 492, 1066
ApoI RAATTY 8 cut(s) 259, 851, 917, 1092, 1154, 1274, 1395, 2195
Asp700I GAANNNNTTC 4 cut(s) 582, 786, 1925, 2197
Asp718I GGTACC 1 cut(s) 1498
AsuHPI GGTGA 5 cut(s) 13, 450, 697, 943, 1392
AsuII TTCGAA 1 cut(s) 1393
BanI GGYRCC 2 cut(s) 79, 1498
Bbv12I GWGCWC 1 cut(s) 1231
BbvI GCAGC 2 cut(s) 504, 1078
BccI CCATC 1 cut(s) 956
BcoDI GTCTC 3 cut(s) 372, 559, 1259
BcuI ACTAGT 2 cut(s) 272, 539
BfaI CTAG 8 cut(s) 273, 374, 540, 660, 903, 1151, 1830, 2135
BfrI CTTAAG 1 cut(s) 1945
BglII AGATCT 1 cut(s) 47
BisI GCNGC 2 cut(s) 493, 1067
BlsI GCNGC 2 cut(s) 494, 1068
BmiI GGNNCC 2 cut(s) 81, 1500
BpmI CTGGAG 1 cut(s) 579
Bpu14I TTCGAA 1 cut(s) 1393
BpuEI CTTGAG 2 cut(s) 646, 2227
Bsa29I ATCGAT 2 cut(s) 1174, 1684
BsaJI CCNNGG 1 cut(s) 681
Bsc4I CCNNNNNNNGG 1 cut(s) 818
Bse1I ACTGG 1 cut(s) 1173
BseCI ATCGAT 2 cut(s) 1174, 1684
BseDI CCNNGG 1 cut(s) 681
BseGI GGATG 2 cut(s) 608, 719
BseLI CCNNNNNNNGG 1 cut(s) 818
BseMII CTCAG 4 cut(s) 179, 249, 502, 2195
BseNI ACTGG 1 cut(s) 1173
BseRI GAGGAG 1 cut(s) 409
BseXI GCAGC 2 cut(s) 504, 1078
BshFI GGCC 1 cut(s) 1010
BshNI GGYRCC 2 cut(s) 79, 1498
BshVI ATCGAT 2 cut(s) 1174, 1684
BsiHKAI GWGCWC 1 cut(s) 1231
BslI CCNNNNNNNGG 1 cut(s) 818
BsmAI GTCTC 3 cut(s) 372, 559, 1259
BsmI GAATGC 1 cut(s) 2106
BsnI GGCC 1 cut(s) 1010
Bsp119I TTCGAA 1 cut(s) 1393
Bsp1286I GDGCHC 1 cut(s) 1231
Bsp1407I TGTACA 3 cut(s) 150, 869, 2126
Bsp143I GATC 9 cut(s) 47, 115, 210, 1171, 1175, 1205, 1681, 1685, 2120
BspANI GGCC 1 cut(s) 1010
BspCNI CTCAG 4 cut(s) 180, 248, 501, 2196
BspDI ATCGAT 2 cut(s) 1174, 1684
BspHI TCATGA 1 cut(s) 1380
BspLI GGNNCC 2 cut(s) 81, 1500
BspPI GGATC 2 cut(s) 123, 1179
BspT104I TTCGAA 1 cut(s) 1393
BspT107I GGYRCC 2 cut(s) 79, 1498
BspTI CTTAAG 1 cut(s) 1945
BsrGI TGTACA 3 cut(s) 150, 869, 2126
BsrI ACTGG 1 cut(s) 1173
BssECI CCNNGG 1 cut(s) 681
BssMI GATC 9 cut(s) 47, 115, 210, 1171, 1175, 1205, 1681, 1685, 2120
BssT1I CCWWGG 1 cut(s) 681
Bst4CI ACNGT 5 cut(s) 644, 708, 991, 1433, 1540
Bst6I CTCTTC 1 cut(s) 391
BstAFI CTTAAG 1 cut(s) 1945
BstAUI TGTACA 3 cut(s) 150, 869, 2126
BstBI TTCGAA 1 cut(s) 1393
BstC8I GCNNGC 2 cut(s) 1227, 1703
BstEII GGTNACC 1 cut(s) 685
BstF5I GGATG 2 cut(s) 608, 719
BstKTI GATC 9 cut(s) 50, 118, 213, 1174, 1178, 1208, 1684, 1688, 2123
BstMAI GTCTC 3 cut(s) 372, 559, 1259
BstMBI GATC 9 cut(s) 47, 115, 210, 1171, 1175, 1205, 1681, 1685, 2120
BstMWI GCNNNNNNNGC 1 cut(s) 77
BstNSI RCATGY 5 cut(s) 39, 1120, 1587, 2146, 2213
BstPI GGTNACC 1 cut(s) 685
BstV1I GCAGC 2 cut(s) 504, 1078
BstX2I RGATCY 1 cut(s) 47
BstYI RGATCY 1 cut(s) 47
Bsu15I ATCGAT 2 cut(s) 1174, 1684
BsuRI GGCC 1 cut(s) 1010
BsuTUI ATCGAT 2 cut(s) 1174, 1684
BtsCI GGATG 2 cut(s) 608, 719
BtsIMutI CAGTG 3 cut(s) 704, 987, 1429
Cac8I GCNNGC 2 cut(s) 1227, 1703
CciI TCATGA 1 cut(s) 1380
ClaI ATCGAT 2 cut(s) 1174, 1684
CseI GACGC 1 cut(s) 147
Csp6I GTAC 6 cut(s) 151, 822, 870, 1499, 2064, 2127
CviQI GTAC 6 cut(s) 151, 822, 870, 1499, 2064, 2127
DpnI GATC 9 cut(s) 49, 117, 212, 1173, 1177, 1207, 1683, 1687, 2122
DpnII GATC 9 cut(s) 47, 115, 210, 1171, 1175, 1205, 1681, 1685, 2120
DraI TTTAAA 3 cut(s) 736, 859, 1159
EaeI YGGCCR 1 cut(s) 1008
Eam1104I CTCTTC 1 cut(s) 391
EarI CTCTTC 1 cut(s) 391
Eco130I CCWWGG 1 cut(s) 681
Eco32I GATATC 1 cut(s) 178
Eco57I CTGAAG 2 cut(s) 327, 654
Eco91I GGTNACC 1 cut(s) 685
EcoO65I GGTNACC 1 cut(s) 685
EcoRI GAATTC 1 cut(s) 917
EcoRV GATATC 1 cut(s) 178
EcoT14I CCWWGG 1 cut(s) 681
ErhI CCWWGG 1 cut(s) 681
FalI AAGNNNNNCTT 2 cut(s) 200, 232
FauNDI CATATG 1 cut(s) 2072
FblI GTMKAC 1 cut(s) 2139
Fnu4HI GCNGC 2 cut(s) 493, 1067
FokI GGATG 2 cut(s) 595, 706
Fsp4HI GCNGC 2 cut(s) 493, 1067
FspBI CTAG 8 cut(s) 273, 374, 540, 660, 903, 1151, 1830, 2135
GluI GCNGC 2 cut(s) 493, 1067
GsuI CTGGAG 1 cut(s) 579
HaeIII GGCC 1 cut(s) 1010
HgaI GACGC 1 cut(s) 147
HincII GTYRAC 2 cut(s) 166, 399
HindII GTYRAC 2 cut(s) 166, 399
HpaI GTTAAC 1 cut(s) 399
HphI GGTGA 5 cut(s) 13, 450, 697, 943, 1392
Hpy188III TCNNGA 9 cut(s) 625, 839, 887, 914, 1025, 1151, 1381, 2024, 2244
HpyAV CCTTC 8 cut(s) 540, 623, 733, 1323, 1512, 1890, 1944, 2253
HpyCH4III ACNGT 5 cut(s) 644, 708, 991, 1433, 1540
HpyCH4V TGCA 6 cut(s) 799, 1533, 1678, 1746, 1808, 2331
HpyF10VI GCNNNNNNNGC 1 cut(s) 77
KpnI GGTACC 1 cut(s) 1502
KspAI GTTAAC 1 cut(s) 399
Kzo9I GATC 9 cut(s) 47, 115, 210, 1171, 1175, 1205, 1681, 1685, 2120
LmnI GCTCC 1 cut(s) 1288
Lsp1109I GCAGC 2 cut(s) 504, 1078
MaeI CTAG 8 cut(s) 273, 374, 540, 660, 903, 1151, 1830, 2135
MaeIII GTNAC 5 cut(s) 685, 715, 1550, 1775, 2306
MalI GATC 9 cut(s) 49, 117, 212, 1173, 1177, 1207, 1683, 1687, 2122
MboI GATC 9 cut(s) 47, 115, 210, 1171, 1175, 1205, 1681, 1685, 2120
MboII GAAGA 8 cut(s) 217, 333, 378, 447, 660, 690, 1382, 1639
MflI RGATCY 1 cut(s) 47
MhlI GDGCHC 1 cut(s) 1231
MlyI GAGTC 2 cut(s) 314, 639
MmeI TCCRAC 5 cut(s) 93, 119, 160, 943, 2236
MroXI GAANNNNTTC 4 cut(s) 582, 786, 1925, 2197
MslI CAYNNNNRTG 2 cut(s) 26, 29
MspCI CTTAAG 1 cut(s) 1945
Mva1269I GAATGC 1 cut(s) 2106
MwoI GCNNNNNNNGC 1 cut(s) 77
NdeI CATATG 1 cut(s) 2072
NdeII GATC 9 cut(s) 47, 115, 210, 1171, 1175, 1205, 1681, 1685, 2120
NlaIV GGNNCC 2 cut(s) 81, 1500
NmeAIII GCCGAG 1 cut(s) 1036
NmuCI GTSAC 2 cut(s) 685, 2306
NspI RCATGY 5 cut(s) 39, 1120, 1587, 2146, 2213
NspV TTCGAA 1 cut(s) 1393
OliI CACNNNNGTG 1 cut(s) 26
PagI TCATGA 1 cut(s) 1380
PciI ACATGT 4 cut(s) 35, 1116, 1583, 2142
PctI GAATGC 1 cut(s) 2106
PdmI GAANNNNTTC 4 cut(s) 582, 786, 1925, 2197
PflMI CCANNNNNTGG 1 cut(s) 818
PkrI GCNGC 2 cut(s) 494, 1068
PleI GAGTC 2 cut(s) 313, 638
PpsI GAGTC 2 cut(s) 313, 638
PscI ACATGT 4 cut(s) 35, 1116, 1583, 2142
PspEI GGTNACC 1 cut(s) 685
PspN4I GGNNCC 2 cut(s) 81, 1500
PsuI RGATCY 1 cut(s) 47
RsaI GTAC 6 cut(s) 152, 823, 871, 1500, 2065, 2128
RsaNI GTAC 6 cut(s) 151, 822, 870, 1499, 2064, 2127
RseI CAYNNNNRTG 2 cut(s) 26, 29
SatI GCNGC 2 cut(s) 493, 1067
Sau3AI GATC 9 cut(s) 47, 115, 210, 1171, 1175, 1205, 1681, 1685, 2120
SchI GAGTC 2 cut(s) 314, 639
SduI GDGCHC 1 cut(s) 1231
SfuI TTCGAA 1 cut(s) 1393
SmiMI CAYNNNNRTG 2 cut(s) 26, 29
SmlI CTYRAG 3 cut(s) 625, 1945, 2242
SmoI CTYRAG 3 cut(s) 625, 1945, 2242
SpeI ACTAGT 2 cut(s) 272, 539
SspI AATATT 1 cut(s) 1420
SspMI CTAG 8 cut(s) 273, 374, 540, 660, 903, 1151, 1830, 2135
StyI CCWWGG 1 cut(s) 681
TaaI ACNGT 5 cut(s) 644, 708, 991, 1433, 1540
TaqI TCGA 5 cut(s) 5, 913, 1174, 1393, 1684
TatI WGTACW 3 cut(s) 150, 869, 2126
TscAI CASTG 3 cut(s) 711, 994, 1436
TseFI GTSAC 2 cut(s) 685, 2306
TseI GCWGC 2 cut(s) 492, 1066
Tsp45I GTSAC 2 cut(s) 685, 2306
TspRI CASTG 3 cut(s) 711, 994, 1436
Van91I CCANNNNNTGG 1 cut(s) 818
Vha464I CTTAAG 1 cut(s) 1945
XapI RAATTY 8 cut(s) 259, 851, 917, 1092, 1154, 1274, 1395, 2195
XbaI TCTAGA 1 cut(s) 1150
XceI RCATGY 5 cut(s) 39, 1120, 1587, 2146, 2213
XmiI GTMKAC 1 cut(s) 2139
XmnI GAANNNNTTC 4 cut(s) 582, 786, 1925, 2197
XspI CTAG 8 cut(s) 273, 374, 540, 660, 903, 1151, 1830, 2135
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.