Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr7

Orthogroup ID

OG0000120

Physical Location & Seq

Genomic Coordinates Reverse (-)

27367834 .. 27368322

Gene Structure 489 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom07g27820.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 489 bp

ATGATGACGGATGCAACAGCTACGATAGTAGCTAGGAACCTCCTCACTCCTAAAGATAGTAGGCTGCTTTCAGGACGGTCCGATGAGTTGCCCGTTCAAGAGTCCCTGGCTCTCAGTGTTCAGTGTGCAGGCTCTGTGTCCAACATGGGCCAACGCCTACTTGCTCGCTCCCGTCAGGTTGAATCGTTGATGGCAGAGGTGGAAAATCATAAGCAGGAGATCAAACAGCTTAAGTACGAGAATAGAAGTTTGCACGTGCTTGCCAACAACTATTCGACGGGCATAAAGAGGAAGCTTGATGAGCTGCAAGAATCTGAAGGTCGGATTCAAAGTGACCGTCAAAGGCTTGCTGCTTATCTCCAGAGGCACCTTTTTCCTGGGTCATCCAGCGTTCCACCAAGTATTGTGGCCTCGAATGATCTAGCTCTGATACCTTCCGCTCCGAGAGTTTTGCCAAATAATGGGACTTCACGTGAACATCCTTTGTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004177 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005829 GO:0006508 GO:0006807 GO:0008150 GO:0008152 GO:0008233 GO:0008238 GO:0008239 GO:0016787 GO:0019538 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044238 GO:0044424 GO:0044444 GO:0044464 GO:0070011 GO:0071704 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

NUDIX Peptidase_M49

Protein Analysis

163

Amino Acids

17.91

Weight (kDa)

9.25

Isoelectric Point (pI)

54.49

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000120)

Species	Orthologous Gene IDs
malus_domestica	MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica	Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis	pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	366
AccB7I	CCANNNNNTGG	1 cut(s)	461
AccBSI	CCGCTC	1 cut(s)	440
AciI	CCGC	1 cut(s)	438
AcuI	CTGAAG	1 cut(s)	336
AcvI	CACGTG	2 cut(s)	256, 473
AfaI	GTAC	1 cut(s)	236
AfiI	CCNNNNNNNGG	1 cut(s)	461
AflII	CTTAAG	1 cut(s)	230
AgsI	TTSAA	3 cut(s)	98, 182, 329
AjnI	CCWGG	2 cut(s)	105, 376
AluBI	AGCT	6 cut(s)	20, 32, 229, 295, 304, 425
AluI	AGCT	6 cut(s)	20, 32, 229, 295, 304, 425
AlwNI	CAGNNNCTG	1 cut(s)	134
AoxI	GGCC	2 cut(s)	148, 408
ApeKI	GCWGC	3 cut(s)	64, 304, 350
ArsI	GACNNNNNNTTYG	2 cut(s)	322, 354
AspS9I	GGNCC	2 cut(s)	78, 148
AvaII	GGWCC	1 cut(s)	78
BanI	GGYRCC	1 cut(s)	366
BbrPI	CACGTG	2 cut(s)	256, 473
BbvI	GCAGC	3 cut(s)	51, 291, 337
BccI	CCATC	1 cut(s)	184
BcgI	CGANNNNNNTGC	2 cut(s)	433, 467
BciT130I	CCWGG	2 cut(s)	107, 378
BfaI	CTAG	2 cut(s)	33, 422
BfrI	CTTAAG	1 cut(s)	230
BisI	GCNGC	3 cut(s)	65, 305, 351
BlsI	GCNGC	3 cut(s)	66, 306, 352
Bme1390I	CCNGG	2 cut(s)	107, 378
Bme18I	GGWCC	1 cut(s)	78
BmgT120I	GGNCC	2 cut(s)	78, 148
BmiI	GGNNCC	2 cut(s)	38, 368
BmrFI	CCNGG	2 cut(s)	107, 378
BpmI	CTGGAG	1 cut(s)	344
BsaAI	YACGTR	2 cut(s)	256, 473
BsaJI	CCNNGG	2 cut(s)	105, 377
Bsc4I	CCNNNNNNNGG	1 cut(s)	461
BseBI	CCWGG	2 cut(s)	107, 378
BseDI	CCNNGG	2 cut(s)	105, 377
BseGI	GGATG	3 cut(s)	16, 383, 478
BseLI	CCNNNNNNNGG	1 cut(s)	461
BseMII	CTCAG	1 cut(s)	127
BseRI	GAGGAG	1 cut(s)	32
BseXI	GCAGC	3 cut(s)	51, 291, 337
BsgI	GTGCAG	1 cut(s)	147
BshFI	GGCC	2 cut(s)	150, 410
BshNI	GGYRCC	1 cut(s)	366
BslFI	GGGAC	2 cut(s)	88, 478
BslI	CCNNNNNNNGG	1 cut(s)	461
BsmFI	GGGAC	2 cut(s)	88, 478
BsnI	GGCC	2 cut(s)	150, 410
Bsp143I	GATC	2 cut(s)	219, 418
BspACI	CCGC	1 cut(s)	438
BspANI	GGCC	2 cut(s)	150, 410
BspCNI	CTCAG	1 cut(s)	126
BspLI	GGNNCC	2 cut(s)	38, 368
BspT107I	GGYRCC	1 cut(s)	366
BspTI	CTTAAG	1 cut(s)	230
BsrBI	CCGCTC	1 cut(s)	440
BssECI	CCNNGG	2 cut(s)	105, 377
BssMI	GATC	2 cut(s)	219, 418
Bst2UI	CCWGG	2 cut(s)	107, 378
Bst4CI	ACNGT	2 cut(s)	78, 338
BstAFI	CTTAAG	1 cut(s)	230
BstBAI	YACGTR	2 cut(s)	256, 473
BstC8I	GCNNGC	4 cut(s)	130, 166, 261, 348
BstDEI	CTNAG	1 cut(s)	113
BstF5I	GGATG	3 cut(s)	16, 383, 478
BstKTI	GATC	2 cut(s)	222, 421
BstMBI	GATC	2 cut(s)	219, 418
BstMWI	GCNNNNNNNGC	1 cut(s)	301
BstNI	CCWGG	2 cut(s)	107, 378
BstSCI	CCNGG	2 cut(s)	105, 376
BstV1I	GCAGC	3 cut(s)	51, 291, 337
BsuRI	GGCC	2 cut(s)	150, 410
BtsCI	GGATG	3 cut(s)	16, 383, 478
BtsIMutI	CAGTG	2 cut(s)	121, 128
Cac8I	GCNNGC	4 cut(s)	130, 166, 261, 348
CaiI	CAGNNNCTG	1 cut(s)	134
Cfr13I	GGNCC	2 cut(s)	78, 148
CpoI	CGGWCCG	1 cut(s)	78
Csp6I	GTAC	1 cut(s)	235
CspCI	CAANNNNNGTGG	2 cut(s)	387, 422
CspI	CGGWCCG	1 cut(s)	78
CviAII	CATG	1 cut(s)	145
CviQI	GTAC	1 cut(s)	235
DdeI	CTNAG	1 cut(s)	113
DpnI	GATC	2 cut(s)	221, 420
DpnII	GATC	2 cut(s)	219, 418
Eco47I	GGWCC	1 cut(s)	78
Eco57I	CTGAAG	1 cut(s)	336
Eco72I	CACGTG	2 cut(s)	256, 473
EcoRII	CCWGG	2 cut(s)	105, 376
FaeI	CATG	1 cut(s)	148
FaiI	YATR	3 cut(s)	146, 210, 284
FaqI	GGGAC	2 cut(s)	88, 478
FatI	CATG	1 cut(s)	144
Fnu4HI	GCNGC	3 cut(s)	65, 305, 351
FokI	GGATG	3 cut(s)	23, 370, 465
Fsp4HI	GCNGC	3 cut(s)	65, 305, 351
FspBI	CTAG	2 cut(s)	33, 422
GluI	GCNGC	3 cut(s)	65, 305, 351
GsuI	CTGGAG	1 cut(s)	344
HaeIII	GGCC	2 cut(s)	150, 410
Hin1II	CATG	1 cut(s)	148
HindIII	AAGCTT	1 cut(s)	293
HinfI	GANTC	4 cut(s)	101, 182, 311, 325
Hpy166II	GTNNAC	1 cut(s)	476
Hpy188I	TCNGA	5 cut(s)	82, 316, 324, 429, 444
Hpy188III	TCNNGA	3 cut(s)	72, 98, 361
Hpy8I	GTNNAC	1 cut(s)	476
Hpy99I	CGWCG	1 cut(s)	280
HpyAV	CCTTC	2 cut(s)	311, 444
HpyCH4III	ACNGT	2 cut(s)	78, 338
HpyCH4IV	ACGT	2 cut(s)	255, 472
HpyCH4V	TGCA	4 cut(s)	14, 128, 253, 307
HpyF10VI	GCNNNNNNNGC	1 cut(s)	301
HpyF3I	CTNAG	1 cut(s)	113
HpySE526I	ACGT	2 cut(s)	255, 472
Hsp92II	CATG	1 cut(s)	148
Kzo9I	GATC	2 cut(s)	219, 418
LmnI	GCTCC	2 cut(s)	173, 445
Lsp1109I	GCAGC	3 cut(s)	51, 291, 337
MaeI	CTAG	2 cut(s)	33, 422
MaeII	ACGT	2 cut(s)	255, 472
MaeIII	GTNAC	1 cut(s)	332
MalI	GATC	2 cut(s)	221, 420
MbiI	CCGCTC	1 cut(s)	440
MboI	GATC	2 cut(s)	219, 418
MlyI	GAGTC	1 cut(s)	110
MmeI	TCCRAC	2 cut(s)	165, 302
MnlI	CCTC	6 cut(s)	50, 53, 190, 282, 357, 421
MseI	TTAA	1 cut(s)	231
MspCI	CTTAAG	1 cut(s)	230
MspR9I	CCNGG	2 cut(s)	107, 378
MvaI	CCWGG	2 cut(s)	107, 378
MwoI	GCNNNNNNNGC	1 cut(s)	301
NdeII	GATC	2 cut(s)	219, 418
NlaIII	CATG	1 cut(s)	148
NlaIV	GGNNCC	2 cut(s)	38, 368
NmuCI	GTSAC	1 cut(s)	332
PfeI	GAWTC	3 cut(s)	182, 311, 325
PflMI	CCANNNNNTGG	1 cut(s)	461
PkrI	GCNGC	3 cut(s)	66, 306, 352
PleI	GAGTC	1 cut(s)	109
PmaCI	CACGTG	2 cut(s)	256, 473
PmlI	CACGTG	2 cut(s)	256, 473
PpsI	GAGTC	1 cut(s)	109
Ppu21I	YACGTR	2 cut(s)	256, 473
Psp6I	CCWGG	2 cut(s)	105, 376
PspCI	CACGTG	2 cut(s)	256, 473
PspGI	CCWGG	2 cut(s)	105, 376
PspN4I	GGNNCC	2 cut(s)	38, 368
PspPI	GGNCC	2 cut(s)	78, 148
PstNI	CAGNNNCTG	1 cut(s)	134
RsaI	GTAC	1 cut(s)	236
RsaNI	GTAC	1 cut(s)	235
Rsr2I	CGGWCCG	1 cut(s)	78
RsrII	CGGWCCG	1 cut(s)	78
SaqAI	TTAA	1 cut(s)	231
SatI	GCNGC	3 cut(s)	65, 305, 351
Sau3AI	GATC	2 cut(s)	219, 418
Sau96I	GGNCC	2 cut(s)	78, 148
SchI	GAGTC	1 cut(s)	110
ScrFI	CCNGG	2 cut(s)	107, 378
SinI	GGWCC	1 cut(s)	78
SmlI	CTYRAG	1 cut(s)	230
SmoI	CTYRAG	1 cut(s)	230
SsiI	CCGC	1 cut(s)	438
SspMI	CTAG	2 cut(s)	33, 422
StyD4I	CCNGG	2 cut(s)	105, 376
TaaI	ACNGT	2 cut(s)	78, 338
TaiI	ACGT	2 cut(s)	258, 475
TaqI	TCGA	2 cut(s)	275, 413
TfiI	GAWTC	3 cut(s)	182, 311, 325
Tru1I	TTAA	1 cut(s)	231
Tru9I	TTAA	1 cut(s)	231
TscAI	CASTG	2 cut(s)	121, 128
TseFI	GTSAC	1 cut(s)	332
TseI	GCWGC	3 cut(s)	64, 304, 350
Tsp45I	GTSAC	1 cut(s)	332
TspGWI	ACGGA	1 cut(s)	23
TspRI	CASTG	2 cut(s)	121, 128
Van91I	CCANNNNNTGG	1 cut(s)	461
Vha464I	CTTAAG	1 cut(s)	230
VpaK11BI	GGWCC	1 cut(s)	78
XspI	CTAG	2 cut(s)	33, 422

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.