pycom02g21560

ethylene-responsive transcription factor

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr2
Physical Location & Seq
Forward (+)
19794314 .. 19796327
2014 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom02g21560.2

Sequence Viewer

Length: 447 bp
ATGACTAACTCATCGAACCTTTGCTTAGATTTGAGTCTCAGCAGCGATCCGGTTGTGCCCCGTCAAGGTAATGTATGGCGCCCTTCTTTTTTATCTTCTAACGGTCCTCTTACAGGTGAAGACTCTGTGATGAAGGACGCAACAACAGCTACGATAGTAGCTAGGAACCTCCTCACTCCTGAAGATAATCGGCTGCTTTCAGGACGGTCTGATGAGTTGGCCGTTCAAGAGTCCCTCGCTCTCAGTGTTCAGTGTGCAGGCTCTGTGTCCAACATGGGCCAACGCCTACTTGCTCGCTCCCGCCAAGTTGAATCCTTGATGGCGGAGGTTGAAACCTCTTCCTTCATTAGTCCACCAGCTTTGAGTGTGTACTCAAAGGCACTGCTCATGAGTCCACCATTGCACCCGGAGTCACATGAACCTGCCTCCTCTGGATCACACTCATGA

Protein Analysis

149

Amino Acids

15.71

Weight (kDa)

5.06

Isoelectric Point (pI)

54.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 430
AccB1I GGYRCC 1 cut(s) 78
AciI CCGC 2 cut(s) 301, 323
AclWI GGATC 2 cut(s) 41, 442
AcoI YGGCCR 1 cut(s) 219
AcuI CTGAAG 1 cut(s) 201
AcyI GRCGYC 1 cut(s) 79
AfaI GTAC 1 cut(s) 371
AfiI CCNNNNNNNGG 2 cut(s) 65, 113
AgsI TTSAA 3 cut(s) 227, 311, 332
AluBI AGCT 3 cut(s) 149, 161, 359
AluI AGCT 3 cut(s) 149, 161, 359
Alw26I GTCTC 1 cut(s) 41
AlwI GGATC 2 cut(s) 41, 442
AlwNI CAGNNNCTG 1 cut(s) 263
AoxI GGCC 2 cut(s) 219, 277
ApeKI GCWGC 2 cut(s) 42, 193
AspLEI GCGC 1 cut(s) 81
AspS9I GGNCC 2 cut(s) 104, 277
AsuC2I CCSGG 1 cut(s) 407
AsuHPI GGTGA 1 cut(s) 128
AvaII GGWCC 1 cut(s) 104
BaeGI GKGCMC 1 cut(s) 60
BanI GGYRCC 1 cut(s) 78
BbsI GAAGAC 1 cut(s) 126
BbvI GCAGC 2 cut(s) 54, 180
BccI CCATC 1 cut(s) 313
BceAI ACGGC 1 cut(s) 206
BcnI CCSGG 1 cut(s) 407
BcoDI GTCTC 1 cut(s) 41
BfaI CTAG 1 cut(s) 162
BfoI RGCGCY 1 cut(s) 82
BfuAI ACCTGC 1 cut(s) 430
BisI GCNGC 2 cut(s) 43, 194
BlsI GCNGC 2 cut(s) 44, 195
Bme1390I CCNGG 1 cut(s) 407
Bme18I GGWCC 1 cut(s) 104
BmgT120I GGNCC 2 cut(s) 104, 277
BmiI GGNNCC 2 cut(s) 80, 167
BmrFI CCNGG 1 cut(s) 407
BpiI GAAGAC 1 cut(s) 126
BpuMI CCSGG 1 cut(s) 407
BsaHI GRCGYC 1 cut(s) 79
BsaWI WCCGGW 1 cut(s) 49
Bsc4I CCNNNNNNNGG 2 cut(s) 65, 113
Bse3DI GCAATG 1 cut(s) 398
BseLI CCNNNNNNNGG 2 cut(s) 65, 113
BseMI GCAATG 1 cut(s) 398
BseMII CTCAG 2 cut(s) 52, 256
BseRI GAGGAG 2 cut(s) 161, 418
BseSI GKGCMC 1 cut(s) 60
BseXI GCAGC 2 cut(s) 54, 180
BsgI GTGCAG 1 cut(s) 276
BshFI GGCC 2 cut(s) 221, 279
BshNI GGYRCC 1 cut(s) 78
BsiSI CCGG 2 cut(s) 50, 407
BslFI GGGAC 1 cut(s) 217
BslI CCNNNNNNNGG 2 cut(s) 65, 113
BsmAI GTCTC 1 cut(s) 41
BsmFI GGGAC 1 cut(s) 217
BsnI GGCC 2 cut(s) 221, 279
Bsp1286I GDGCHC 1 cut(s) 60
Bsp143I GATC 2 cut(s) 46, 434
BspACI CCGC 2 cut(s) 301, 323
BspANI GGCC 2 cut(s) 221, 279
BspCNI CTCAG 2 cut(s) 51, 255
BspHI TCATGA 2 cut(s) 387, 443
BspLI GGNNCC 2 cut(s) 80, 167
BspMI ACCTGC 1 cut(s) 430
BspPI GGATC 2 cut(s) 41, 442
BspT107I GGYRCC 1 cut(s) 78
BsrDI GCAATG 1 cut(s) 398
BssMI GATC 2 cut(s) 46, 434
BssNI GRCGYC 1 cut(s) 79
Bst4CI ACNGT 2 cut(s) 104, 207
Bst6I CTCTTC 1 cut(s) 343
BstACI GRCGYC 1 cut(s) 79
BstC8I GCNNGC 2 cut(s) 259, 295
BstDEI CTNAG 3 cut(s) 25, 38, 242
BstENI CCTNNNNNAGG 1 cut(s) 111
BstH2I RGCGCY 1 cut(s) 82
BstHHI GCGC 1 cut(s) 81
BstKTI GATC 2 cut(s) 49, 437
BstMAI GTCTC 1 cut(s) 41
BstMBI GATC 2 cut(s) 46, 434
BstMWI GCNNNNNNNGC 1 cut(s) 146
BstSCI CCNGG 1 cut(s) 405
BstSLI GKGCMC 1 cut(s) 60
BstV1I GCAGC 2 cut(s) 54, 180
BstV2I GAAGAC 1 cut(s) 126
BsuRI GGCC 2 cut(s) 221, 279
BtsI GCAGTG 1 cut(s) 380
BtsIMutI CAGTG 3 cut(s) 250, 257, 380
BveI ACCTGC 1 cut(s) 430
Cac8I GCNNGC 2 cut(s) 259, 295
CaiI CAGNNNCTG 1 cut(s) 263
CciI TCATGA 2 cut(s) 387, 443
CfoI GCGC 1 cut(s) 81
Cfr13I GGNCC 2 cut(s) 104, 277
CseI GACGC 1 cut(s) 146
Csp6I GTAC 1 cut(s) 370
CspCI CAANNNNNGTGG 2 cut(s) 342, 377
CviAII CATG 4 cut(s) 274, 388, 416, 444
CviJI RGCY 7 cut(s) 149, 161, 193, 221, 261, 279, 359
CviKI_1 RGCY 7 cut(s) 149, 161, 193, 221, 261, 279, 359
CviQI GTAC 1 cut(s) 370
DdeI CTNAG 3 cut(s) 25, 38, 242
DinI GGCGCC 1 cut(s) 80
DpnI GATC 2 cut(s) 48, 436
DpnII GATC 2 cut(s) 46, 434
EaeI YGGCCR 1 cut(s) 219
Eam1104I CTCTTC 1 cut(s) 343
EarI CTCTTC 1 cut(s) 343
EciI GGCGGA 1 cut(s) 338
Eco47I GGWCC 1 cut(s) 104
Eco57I CTGAAG 1 cut(s) 201
EcoNI CCTNNNNNAGG 1 cut(s) 111
EgeI GGCGCC 1 cut(s) 80
EheI GGCGCC 1 cut(s) 80
FaeI CATG 4 cut(s) 277, 391, 419, 447
FaiI YATR 5 cut(s) 76, 275, 389, 417, 445
FaqI GGGAC 1 cut(s) 217
FatI CATG 4 cut(s) 273, 387, 415, 443
FauI CCCGC 1 cut(s) 308
Fnu4HI GCNGC 2 cut(s) 43, 194
Fsp4HI GCNGC 2 cut(s) 43, 194
FspBI CTAG 1 cut(s) 162
GlaI GCGC 1 cut(s) 80
GluI GCNGC 2 cut(s) 43, 194
HaeII RGCGCY 1 cut(s) 82
HaeIII GGCC 2 cut(s) 221, 279
HapII CCGG 2 cut(s) 50, 407
HgaI GACGC 1 cut(s) 146
HhaI GCGC 1 cut(s) 81
Hin1I GRCGYC 1 cut(s) 79
Hin1II CATG 4 cut(s) 277, 391, 419, 447
Hin6I GCGC 1 cut(s) 79
HinP1I GCGC 1 cut(s) 79
HinfI GANTC 6 cut(s) 34, 122, 230, 311, 391, 410
HpaII CCGG 2 cut(s) 50, 407
HphI GGTGA 1 cut(s) 128
Hpy166II GTNNAC 3 cut(s) 353, 370, 395
Hpy188I TCNGA 1 cut(s) 211
Hpy188III TCNNGA 6 cut(s) 179, 201, 227, 388, 432, 444
Hpy8I GTNNAC 3 cut(s) 353, 370, 395
HpyAV CCTTC 3 cut(s) 93, 127, 352
HpyCH4III ACNGT 2 cut(s) 104, 207
HpyCH4V TGCA 2 cut(s) 257, 403
HpyF10VI GCNNNNNNNGC 1 cut(s) 146
HpyF3I CTNAG 3 cut(s) 25, 38, 242
Hsp92I GRCGYC 1 cut(s) 79
Hsp92II CATG 4 cut(s) 277, 391, 419, 447
HspAI GCGC 1 cut(s) 79
KasI GGCGCC 1 cut(s) 78
Kzo9I GATC 2 cut(s) 46, 434
LmnI GCTCC 1 cut(s) 302
LpnPI CCDG 9 cut(s) 63, 99, 186, 192, 243, 369, 417, 420, 435
Lsp1109I GCAGC 2 cut(s) 54, 180
MaeI CTAG 1 cut(s) 162
MaeIII GTNAC 1 cut(s) 411
MalI GATC 2 cut(s) 48, 436
MboI GATC 2 cut(s) 46, 434
MboII GAAGA 4 cut(s) 87, 131, 194, 330
MhlI GDGCHC 1 cut(s) 60
Mly113I GGCGCC 1 cut(s) 79
MlyI GAGTC 5 cut(s) 43, 116, 239, 400, 419
MmeI TCCRAC 1 cut(s) 294
MnlI CCTC 8 cut(s) 117, 179, 182, 245, 319, 346, 436, 439
MslI CAYNNNNRTG 1 cut(s) 442
MspI CCGG 2 cut(s) 50, 407
MspR9I CCNGG 1 cut(s) 407
MwoI GCNNNNNNNGC 1 cut(s) 146
NarI GGCGCC 1 cut(s) 79
NciI CCSGG 1 cut(s) 407
NdeII GATC 2 cut(s) 46, 434
NlaIII CATG 4 cut(s) 277, 391, 419, 447
NlaIV GGNNCC 2 cut(s) 80, 167
NmuCI GTSAC 1 cut(s) 411
PagI TCATGA 2 cut(s) 387, 443
PfeI GAWTC 1 cut(s) 311
PkrI GCNGC 2 cut(s) 44, 195
PleI GAGTC 5 cut(s) 42, 116, 238, 399, 418
PluTI GGCGCC 1 cut(s) 82
PpsI GAGTC 5 cut(s) 42, 116, 238, 399, 418
PspN4I GGNNCC 2 cut(s) 80, 167
PspPI GGNCC 2 cut(s) 104, 277
PstNI CAGNNNCTG 1 cut(s) 263
RsaI GTAC 1 cut(s) 371
RsaNI GTAC 1 cut(s) 370
RseI CAYNNNNRTG 1 cut(s) 442
SatI GCNGC 2 cut(s) 43, 194
Sau3AI GATC 2 cut(s) 46, 434
Sau96I GGNCC 2 cut(s) 104, 277
SchI GAGTC 5 cut(s) 43, 116, 239, 400, 419
ScrFI CCNGG 1 cut(s) 407
SduI GDGCHC 1 cut(s) 60
SfoI GGCGCC 1 cut(s) 80
SinI GGWCC 1 cut(s) 104
SmiMI CAYNNNNRTG 1 cut(s) 442
SsiI CCGC 2 cut(s) 301, 323
SspDI GGCGCC 1 cut(s) 78
SspMI CTAG 1 cut(s) 162
StyD4I CCNGG 1 cut(s) 405
TaaI ACNGT 2 cut(s) 104, 207
TaqI TCGA 1 cut(s) 14
TatI WGTACW 1 cut(s) 369
TfiI GAWTC 1 cut(s) 311
TscAI CASTG 3 cut(s) 250, 257, 387
TseFI GTSAC 1 cut(s) 411
TseI GCWGC 2 cut(s) 42, 193
Tsp45I GTSAC 1 cut(s) 411
TspDTI ATGAA 3 cut(s) 146, 334, 432
TspRI CASTG 3 cut(s) 250, 257, 387
VpaK11BI GGWCC 1 cut(s) 104
XagI CCTNNNNNAGG 1 cut(s) 111
XspI CTAG 1 cut(s) 162
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.