pycom09g09700

Nudix hydrolase 3-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr9
Physical Location & Seq
Forward (+)
7814839 .. 7815456
618 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 618 bp
ATGGCTAACCCATCTAACATTTGCTTAGATTTGAGTCTCAGCAGTGATACGGGTGCGCCGCGTCAGAGTAATATATGGTGCCCGTCTTTCTTATCTTCTAATGACCCTCTTACAGGTGAAGACTCCGTGATGAAGGATGTAACAACAGCTACGATAGTAGCTAGGAACCTCCTCACTCCTAGAGATAATAGGCTGTTTTCAAGACGGTCCAATGAGTTGGCCGTTCAAGAGTCCCTAGCTCTAAGTGTTCAGTGTGCAGGCTCTGTGTCTAACATGGGCCAACGCCTACTTGCTCGAACCCGTCAAGTTGAATCATTGATGGCGGAGGTGGAAAATCTTAGACAAGAGATCAAACAGCTTAAGCGTGAGAATAATGATTTGTACATGCTTGCAAATAATTATTCGACGAGCATAAAGAGGAAGCTTGATCAGCTGCAAGAATCTGAAAGTCGAATTCAAAGTGACCGTCAAAGGCTTGCGGCTTTCTTCCAGAGGCACTTTTTGCCTTCATCATCTAGCGTTCAACCAAATATTGAGGCCTCGAATGATCTGTCCTCGATGCCTCCCGCTCCTGGAGTTTTGCTAAGTAGTGGGGCTTCACGTCAGCAACCTTTGTGA

Protein Analysis

206

Amino Acids

22.71

Weight (kDa)

7.72

Isoelectric Point (pI)

70.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 78
AccBSI CCGCTC 1 cut(s) 569
AccII CGCG 1 cut(s) 61
AciI CCGC 4 cut(s) 59, 323, 479, 567
AcoI YGGCCR 1 cut(s) 219
AcsI RAATTY 1 cut(s) 453
AfaI GTAC 1 cut(s) 383
AfiI CCNNNNNNNGG 2 cut(s) 113, 572
AflII CTTAAG 1 cut(s) 359
AgsI TTSAA 5 cut(s) 201, 227, 311, 458, 524
AjiI CACGTC 1 cut(s) 602
AjnI CCWGG 1 cut(s) 571
AluBI AGCT 6 cut(s) 149, 161, 239, 358, 424, 433
AluI AGCT 6 cut(s) 149, 161, 239, 358, 424, 433
Alw26I GTCTC 1 cut(s) 41
AlwNI CAGNNNCTG 1 cut(s) 263
AoxI GGCC 3 cut(s) 219, 277, 537
ApeKI GCWGC 1 cut(s) 433
ApoI RAATTY 1 cut(s) 453
ArsI GACNNNNNNTTYG 4 cut(s) 451, 483, 536, 568
AspLEI GCGC 1 cut(s) 58
AspS9I GGNCC 2 cut(s) 207, 277
AsuHPI GGTGA 1 cut(s) 128
AvaII GGWCC 1 cut(s) 207
BaeGI GKGCMC 1 cut(s) 83
BanI GGYRCC 1 cut(s) 78
BarI GAAGNNNNNNTAC 2 cut(s) 580, 612
BbsI GAAGAC 1 cut(s) 126
BbvI GCAGC 1 cut(s) 420
BccI CCATC 2 cut(s) 19, 313
BceAI ACGGC 1 cut(s) 206
BciT130I CCWGG 1 cut(s) 573
BclI TGATCA 1 cut(s) 427
BcoDI GTCTC 1 cut(s) 41
BfaI CTAG 4 cut(s) 162, 180, 236, 516
BfrI CTTAAG 1 cut(s) 359
BisI GCNGC 3 cut(s) 59, 434, 480
BlsI GCNGC 3 cut(s) 60, 435, 481
Bme1390I CCNGG 1 cut(s) 573
Bme18I GGWCC 1 cut(s) 207
BmgBI CACGTC 1 cut(s) 602
BmgT120I GGNCC 2 cut(s) 207, 277
BmiI GGNNCC 2 cut(s) 80, 167
BmrFI CCNGG 1 cut(s) 573
BmsI GCATC 1 cut(s) 549
BpiI GAAGAC 1 cut(s) 126
BpmI CTGGAG 1 cut(s) 594
Bsc4I CCNNNNNNNGG 2 cut(s) 113, 572
BseBI CCWGG 1 cut(s) 573
BseGI GGATG 1 cut(s) 142
BseLI CCNNNNNNNGG 2 cut(s) 113, 572
BseMII CTCAG 1 cut(s) 52
BseRI GAGGAG 1 cut(s) 161
BseSI GKGCMC 1 cut(s) 83
BseXI GCAGC 1 cut(s) 420
BsgI GTGCAG 1 cut(s) 276
Bsh1236I CGCG 1 cut(s) 61
BshFI GGCC 3 cut(s) 221, 279, 539
BshNI GGYRCC 1 cut(s) 78
BslFI GGGAC 1 cut(s) 217
BslI CCNNNNNNNGG 2 cut(s) 113, 572
BsmAI GTCTC 1 cut(s) 41
BsmFI GGGAC 1 cut(s) 217
BsnI GGCC 3 cut(s) 221, 279, 539
Bsp1286I GDGCHC 1 cut(s) 83
Bsp1407I TGTACA 1 cut(s) 381
Bsp143I GATC 3 cut(s) 348, 427, 547
BspACI CCGC 4 cut(s) 59, 323, 479, 567
BspANI GGCC 3 cut(s) 221, 279, 539
BspCNI CTCAG 1 cut(s) 51
BspFNI CGCG 1 cut(s) 61
BspLI GGNNCC 2 cut(s) 80, 167
BspT107I GGYRCC 1 cut(s) 78
BspTI CTTAAG 1 cut(s) 359
BsrBI CCGCTC 1 cut(s) 569
BsrGI TGTACA 1 cut(s) 381
BssMI GATC 3 cut(s) 348, 427, 547
Bst2UI CCWGG 1 cut(s) 573
Bst4CI ACNGT 2 cut(s) 207, 467
BstAFI CTTAAG 1 cut(s) 359
BstAPI GCANNNNNTGC 1 cut(s) 502
BstAUI TGTACA 1 cut(s) 381
BstC8I GCNNGC 3 cut(s) 259, 390, 477
BstDEI CTNAG 5 cut(s) 25, 38, 242, 338, 584
BstENI CCTNNNNNAGG 1 cut(s) 111
BstF5I GGATG 1 cut(s) 142
BstFNI CGCG 1 cut(s) 61
BstHHI GCGC 1 cut(s) 58
BstKTI GATC 3 cut(s) 351, 430, 550
BstMAI GTCTC 1 cut(s) 41
BstMBI GATC 3 cut(s) 348, 427, 547
BstMWI GCNNNNNNNGC 2 cut(s) 430, 502
BstNI CCWGG 1 cut(s) 573
BstNSI RCATGY 1 cut(s) 388
BstSCI CCNGG 1 cut(s) 571
BstSLI GKGCMC 1 cut(s) 83
BstUI CGCG 1 cut(s) 61
BstV1I GCAGC 1 cut(s) 420
BstV2I GAAGAC 1 cut(s) 126
BstXI CCANNNNNNTGG 1 cut(s) 217
BsuRI GGCC 3 cut(s) 221, 279, 539
BtrI CACGTC 1 cut(s) 602
BtsCI GGATG 1 cut(s) 142
BtsI GCAGTG 1 cut(s) 49
BtsIMutI CAGTG 2 cut(s) 49, 257
Cac8I GCNNGC 3 cut(s) 259, 390, 477
CaiI CAGNNNCTG 1 cut(s) 263
CfoI GCGC 1 cut(s) 58
Cfr13I GGNCC 2 cut(s) 207, 277
CseI GACGC 1 cut(s) 50
Csp6I GTAC 1 cut(s) 382
CviAII CATG 2 cut(s) 274, 385
CviQI GTAC 1 cut(s) 382
DdeI CTNAG 5 cut(s) 25, 38, 242, 338, 584
DpnI GATC 3 cut(s) 350, 429, 549
DpnII GATC 3 cut(s) 348, 427, 547
EaeI YGGCCR 1 cut(s) 219
EciI GGCGGA 1 cut(s) 338
Eco147I AGGCCT 1 cut(s) 539
Eco47I GGWCC 1 cut(s) 207
EcoNI CCTNNNNNAGG 1 cut(s) 111
EcoRI GAATTC 1 cut(s) 453
EcoRII CCWGG 1 cut(s) 571
FaeI CATG 2 cut(s) 277, 388
FaiI YATR 5 cut(s) 74, 76, 275, 386, 413
FaqI GGGAC 1 cut(s) 217
FatI CATG 2 cut(s) 273, 384
FauI CCCGC 1 cut(s) 574
FbaI TGATCA 1 cut(s) 427
Fnu4HI GCNGC 3 cut(s) 59, 434, 480
FokI GGATG 1 cut(s) 149
Fsp4HI GCNGC 3 cut(s) 59, 434, 480
FspBI CTAG 4 cut(s) 162, 180, 236, 516
GlaI GCGC 1 cut(s) 57
GluI GCNGC 3 cut(s) 59, 434, 480
GsuI CTGGAG 1 cut(s) 594
HaeIII GGCC 3 cut(s) 221, 279, 539
HgaI GACGC 1 cut(s) 50
HhaI GCGC 1 cut(s) 58
Hin1II CATG 2 cut(s) 277, 388
Hin6I GCGC 1 cut(s) 56
HinP1I GCGC 1 cut(s) 56
HindIII AAGCTT 1 cut(s) 422
HinfI GANTC 5 cut(s) 34, 122, 230, 311, 440
HphI GGTGA 1 cut(s) 128
Hpy188I TCNGA 2 cut(s) 66, 445
Hpy188III TCNNGA 3 cut(s) 201, 227, 490
Hpy99I CGWCG 1 cut(s) 409
HpyAV CCTTC 2 cut(s) 127, 516
HpyCH4III ACNGT 2 cut(s) 207, 467
HpyCH4IV ACGT 1 cut(s) 601
HpyCH4V TGCA 3 cut(s) 257, 392, 436
HpyF10VI GCNNNNNNNGC 2 cut(s) 430, 502
HpyF3I CTNAG 5 cut(s) 25, 38, 242, 338, 584
HpySE526I ACGT 1 cut(s) 601
Hsp92II CATG 2 cut(s) 277, 388
HspAI GCGC 1 cut(s) 56
Ksp22I TGATCA 1 cut(s) 427
Kzo9I GATC 3 cut(s) 348, 427, 547
LmnI GCTCC 1 cut(s) 574
LpnPI CCDG 5 cut(s) 99, 243, 503, 558, 585
Lsp1109I GCAGC 1 cut(s) 420
LweI GCATC 1 cut(s) 549
MaeI CTAG 4 cut(s) 162, 180, 236, 516
MaeII ACGT 1 cut(s) 601
MaeIII GTNAC 2 cut(s) 139, 461
MalI GATC 3 cut(s) 350, 429, 549
MbiI CCGCTC 1 cut(s) 569
MboI GATC 3 cut(s) 348, 427, 547
MboII GAAGA 3 cut(s) 87, 131, 478
MhlI GDGCHC 1 cut(s) 83
MluCI AATT 2 cut(s) 397, 453
MlyI GAGTC 3 cut(s) 43, 116, 239
MseI TTAA 1 cut(s) 360
MspA1I CMGCKG 1 cut(s) 433
MspCI CTTAAG 1 cut(s) 359
MspR9I CCNGG 1 cut(s) 573
MvaI CCWGG 1 cut(s) 573
MvnI CGCG 1 cut(s) 61
MwoI GCNNNNNNNGC 2 cut(s) 430, 502
NdeII GATC 3 cut(s) 348, 427, 547
NlaIII CATG 2 cut(s) 277, 388
NlaIV GGNNCC 2 cut(s) 80, 167
NmuCI GTSAC 1 cut(s) 461
NspI RCATGY 1 cut(s) 388
PceI AGGCCT 1 cut(s) 539
PfeI GAWTC 2 cut(s) 311, 440
PfoI TCCNGGA 1 cut(s) 571
PkrI GCNGC 3 cut(s) 60, 435, 481
PleI GAGTC 3 cut(s) 42, 116, 238
PpsI GAGTC 3 cut(s) 42, 116, 238
Psp6I CCWGG 1 cut(s) 571
PspGI CCWGG 1 cut(s) 571
PspN4I GGNNCC 2 cut(s) 80, 167
PspPI GGNCC 2 cut(s) 207, 277
PstNI CAGNNNCTG 1 cut(s) 263
PvuII CAGCTG 1 cut(s) 433
RsaI GTAC 1 cut(s) 383
RsaNI GTAC 1 cut(s) 382
SaqAI TTAA 1 cut(s) 360
SatI GCNGC 3 cut(s) 59, 434, 480
Sau3AI GATC 3 cut(s) 348, 427, 547
Sau96I GGNCC 2 cut(s) 207, 277
SchI GAGTC 3 cut(s) 43, 116, 239
ScrFI CCNGG 1 cut(s) 573
SduI GDGCHC 1 cut(s) 83
SfaNI GCATC 1 cut(s) 549
SinI GGWCC 1 cut(s) 207
SmlI CTYRAG 1 cut(s) 359
SmoI CTYRAG 1 cut(s) 359
Sse9I AATT 2 cut(s) 397, 453
SseBI AGGCCT 1 cut(s) 539
SsiI CCGC 4 cut(s) 59, 323, 479, 567
SspI AATATT 1 cut(s) 532
SspMI CTAG 4 cut(s) 162, 180, 236, 516
StuI AGGCCT 1 cut(s) 539
StyD4I CCNGG 1 cut(s) 571
TaaI ACNGT 2 cut(s) 207, 467
TaiI ACGT 1 cut(s) 604
TaqI TCGA 5 cut(s) 295, 404, 451, 542, 557
TasI AATT 2 cut(s) 397, 453
TatI WGTACW 1 cut(s) 381
TauI GCSGC 2 cut(s) 61, 482
TfiI GAWTC 2 cut(s) 311, 440
Tru1I TTAA 1 cut(s) 360
Tru9I TTAA 1 cut(s) 360
TscAI CASTG 2 cut(s) 49, 257
TseFI GTSAC 1 cut(s) 461
TseI GCWGC 1 cut(s) 433
Tsp45I GTSAC 1 cut(s) 461
TspDTI ATGAA 2 cut(s) 146, 498
TspGWI ACGGA 1 cut(s) 115
TspRI CASTG 2 cut(s) 49, 257
Vha464I CTTAAG 1 cut(s) 359
VpaK11BI GGWCC 1 cut(s) 207
XagI CCTNNNNNAGG 1 cut(s) 111
XapI RAATTY 1 cut(s) 453
XceI RCATGY 1 cut(s) 388
XspI CTAG 4 cut(s) 162, 180, 236, 516
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.