pycom10g02170

Nudix hydrolase 3-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr10
Physical Location & Seq
Forward (+)
2380599 .. 2381255
657 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 657 bp
ATGACTAACCCATCGAACCTTTGCTTAGATTTGAGTTTCAGCAGTGATCCGGTTGCACCGCGTCAAGGTAATGTATGGCGCCCTTCTTTCTTATCTTCTAACGGTCCTCTTACAGGTGAAGACTCCATGATGACGGATGCAACAACAGCTACAATAGTAGCTAGGAACCTCCTCACTCCTAAAGATAGTAGGCTGCTTTCAGGACGGTCCGATAAGTTGGCCGTTCAAGAGTCCCTAGCTCTCAGCGTTCAGTGTGCGGGCTCTGTGTCCAACATGGGCCAACGCCTACTTGCTCGCTCCCGTCAAGTTGAATCGTTGATGGCAGAGGTGGAAAATCTCAAGCAAGATGAAGGATCGATCAAACAGCTTAAGTACGAGAATAGAAGTTTGCACGTGCTTGCACATAACTATTCGACGGGCATGAAGAGTAAGCTTGATGAGCTGCAAGAATCTGAAGGTCGGATTCAAAGTGACCGTCAAAGGCTTGCGGCTTATCTCCAGAGGCACCTTTTTCCTGGGTCATCCAGCGTTTCACCAAGTATTGAGGCCTCGAATGATCTATCTTTGATGCCTCCCGCTTCGATGCCTCCCGCTCTGATGCCTCCCGCTCCGAGAGTTTTGCCAAGTAATGGGGCTTCACGTGAACATCCTTTGTGA

Protein Analysis

219

Amino Acids

23.67

Weight (kDa)

6.91

Isoelectric Point (pI)

58.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 78, 504
AccB7I CCANNNNNTGG 1 cut(s) 629
AccBSI CCGCTC 2 cut(s) 593, 608
AccII CGCG 1 cut(s) 61
AciI CCGC 6 cut(s) 59, 257, 488, 576, 591, 606
AclWI GGATC 2 cut(s) 41, 361
AcoI YGGCCR 1 cut(s) 219
AcuI CTGAAG 1 cut(s) 474
AcvI CACGTG 2 cut(s) 394, 641
AcyI GRCGYC 1 cut(s) 79
AfaI GTAC 1 cut(s) 374
AfiI CCNNNNNNNGG 3 cut(s) 65, 113, 629
AflII CTTAAG 1 cut(s) 368
AgsI TTSAA 3 cut(s) 227, 311, 467
AjnI CCWGG 1 cut(s) 514
AluBI AGCT 6 cut(s) 149, 161, 239, 367, 433, 442
AluI AGCT 6 cut(s) 149, 161, 239, 367, 433, 442
AlwI GGATC 2 cut(s) 41, 361
AoxI GGCC 3 cut(s) 219, 277, 546
ApeKI GCWGC 2 cut(s) 193, 442
ArsI GACNNNNNNTTYG 2 cut(s) 460, 492
AspLEI GCGC 1 cut(s) 81
AspS9I GGNCC 3 cut(s) 104, 207, 277
AsuHPI GGTGA 2 cut(s) 128, 525
AvaII GGWCC 2 cut(s) 104, 207
BanI GGYRCC 2 cut(s) 78, 504
BanII GRGCYC 1 cut(s) 263
BarI GAAGNNNNNNTAC 2 cut(s) 619, 651
BbrPI CACGTG 2 cut(s) 394, 641
BbsI GAAGAC 1 cut(s) 126
BbvI GCAGC 2 cut(s) 180, 429
BccI CCATC 2 cut(s) 19, 313
BceAI ACGGC 1 cut(s) 206
BcgI CGANNNNNNTGC 2 cut(s) 601, 635
BciT130I CCWGG 1 cut(s) 516
BfaI CTAG 2 cut(s) 162, 236
BfoI RGCGCY 1 cut(s) 82
BfrI CTTAAG 1 cut(s) 368
BisI GCNGC 3 cut(s) 194, 443, 489
BlsI GCNGC 3 cut(s) 195, 444, 490
Bme1390I CCNGG 1 cut(s) 516
Bme18I GGWCC 2 cut(s) 104, 207
BmgT120I GGNCC 3 cut(s) 104, 207, 277
BmiI GGNNCC 3 cut(s) 80, 167, 506
BmrFI CCNGG 1 cut(s) 516
BmsI GCATC 4 cut(s) 127, 558, 573, 588
BpiI GAAGAC 1 cut(s) 126
BpmI CTGGAG 1 cut(s) 482
BpuEI CTTGAG 1 cut(s) 323
Bsa29I ATCGAT 1 cut(s) 356
BsaAI YACGTR 2 cut(s) 394, 641
BsaHI GRCGYC 1 cut(s) 79
BsaJI CCNNGG 1 cut(s) 515
BsaWI WCCGGW 1 cut(s) 49
Bsc4I CCNNNNNNNGG 3 cut(s) 65, 113, 629
BseBI CCWGG 1 cut(s) 516
BseCI ATCGAT 1 cut(s) 356
BseDI CCNNGG 1 cut(s) 515
BseGI GGATG 3 cut(s) 142, 521, 646
BseLI CCNNNNNNNGG 3 cut(s) 65, 113, 629
BseMII CTCAG 1 cut(s) 256
BseRI GAGGAG 1 cut(s) 161
BseXI GCAGC 2 cut(s) 180, 429
Bsh1236I CGCG 1 cut(s) 61
BshFI GGCC 3 cut(s) 221, 279, 548
BshNI GGYRCC 2 cut(s) 78, 504
BshVI ATCGAT 1 cut(s) 356
BsiSI CCGG 1 cut(s) 50
BslFI GGGAC 1 cut(s) 217
BslI CCNNNNNNNGG 3 cut(s) 65, 113, 629
BsmFI GGGAC 1 cut(s) 217
BsnI GGCC 3 cut(s) 221, 279, 548
Bsp1286I GDGCHC 1 cut(s) 263
Bsp143I GATC 4 cut(s) 46, 353, 357, 556
BspACI CCGC 6 cut(s) 59, 257, 488, 576, 591, 606
BspANI GGCC 3 cut(s) 221, 279, 548
BspCNI CTCAG 1 cut(s) 255
BspDI ATCGAT 1 cut(s) 356
BspFNI CGCG 1 cut(s) 61
BspLI GGNNCC 3 cut(s) 80, 167, 506
BspPI GGATC 2 cut(s) 41, 361
BspT107I GGYRCC 2 cut(s) 78, 504
BspTI CTTAAG 1 cut(s) 368
BsrBI CCGCTC 2 cut(s) 593, 608
BssECI CCNNGG 1 cut(s) 515
BssMI GATC 4 cut(s) 46, 353, 357, 556
BssNI GRCGYC 1 cut(s) 79
Bst2UI CCWGG 1 cut(s) 516
Bst4CI ACNGT 3 cut(s) 104, 207, 476
Bst6I CTCTTC 1 cut(s) 419
BstACI GRCGYC 1 cut(s) 79
BstAFI CTTAAG 1 cut(s) 368
BstBAI YACGTR 2 cut(s) 394, 641
BstC8I GCNNGC 4 cut(s) 259, 295, 399, 486
BstDEI CTNAG 2 cut(s) 25, 242
BstENI CCTNNNNNAGG 1 cut(s) 111
BstF5I GGATG 3 cut(s) 142, 521, 646
BstFNI CGCG 1 cut(s) 61
BstH2I RGCGCY 1 cut(s) 82
BstHHI GCGC 1 cut(s) 81
BstKTI GATC 4 cut(s) 49, 356, 360, 559
BstMBI GATC 4 cut(s) 46, 353, 357, 556
BstMWI GCNNNNNNNGC 2 cut(s) 146, 439
BstNI CCWGG 1 cut(s) 516
BstSCI CCNGG 1 cut(s) 514
BstUI CGCG 1 cut(s) 61
BstV1I GCAGC 2 cut(s) 180, 429
BstV2I GAAGAC 1 cut(s) 126
Bsu15I ATCGAT 1 cut(s) 356
BsuRI GGCC 3 cut(s) 221, 279, 548
BsuTUI ATCGAT 1 cut(s) 356
BtsCI GGATG 3 cut(s) 142, 521, 646
BtsI GCAGTG 1 cut(s) 49
BtsIMutI CAGTG 2 cut(s) 49, 257
Cac8I GCNNGC 4 cut(s) 259, 295, 399, 486
CfoI GCGC 1 cut(s) 81
Cfr13I GGNCC 3 cut(s) 104, 207, 277
ClaI ATCGAT 1 cut(s) 356
CpoI CGGWCCG 1 cut(s) 207
CseI GACGC 1 cut(s) 50
Csp6I GTAC 1 cut(s) 373
CspI CGGWCCG 1 cut(s) 207
CviAII CATG 3 cut(s) 127, 274, 421
CviQI GTAC 1 cut(s) 373
DdeI CTNAG 2 cut(s) 25, 242
DinI GGCGCC 1 cut(s) 80
DpnI GATC 4 cut(s) 48, 355, 359, 558
DpnII GATC 4 cut(s) 46, 353, 357, 556
EaeI YGGCCR 1 cut(s) 219
Eam1104I CTCTTC 1 cut(s) 419
EarI CTCTTC 1 cut(s) 419
Eco147I AGGCCT 1 cut(s) 548
Eco24I GRGCYC 1 cut(s) 263
Eco47I GGWCC 2 cut(s) 104, 207
Eco57I CTGAAG 1 cut(s) 474
Eco72I CACGTG 2 cut(s) 394, 641
EcoNI CCTNNNNNAGG 1 cut(s) 111
EcoRII CCWGG 1 cut(s) 514
EcoT38I GRGCYC 1 cut(s) 263
EgeI GGCGCC 1 cut(s) 80
EheI GGCGCC 1 cut(s) 80
FaeI CATG 3 cut(s) 130, 277, 424
FaiI YATR 5 cut(s) 76, 128, 275, 405, 422
FaqI GGGAC 1 cut(s) 217
FatI CATG 3 cut(s) 126, 273, 420
FauI CCCGC 4 cut(s) 250, 583, 598, 613
Fnu4HI GCNGC 3 cut(s) 194, 443, 489
FokI GGATG 3 cut(s) 149, 508, 633
FriOI GRGCYC 1 cut(s) 263
Fsp4HI GCNGC 3 cut(s) 194, 443, 489
FspBI CTAG 2 cut(s) 162, 236
GlaI GCGC 1 cut(s) 80
GluI GCNGC 3 cut(s) 194, 443, 489
GsuI CTGGAG 1 cut(s) 482
HaeII RGCGCY 1 cut(s) 82
HaeIII GGCC 3 cut(s) 221, 279, 548
HapII CCGG 1 cut(s) 50
HgaI GACGC 1 cut(s) 50
HhaI GCGC 1 cut(s) 81
Hin1I GRCGYC 1 cut(s) 79
Hin1II CATG 3 cut(s) 130, 277, 424
Hin6I GCGC 1 cut(s) 79
HinP1I GCGC 1 cut(s) 79
HindIII AAGCTT 1 cut(s) 431
HinfI GANTC 5 cut(s) 122, 230, 311, 449, 463
HpaII CCGG 1 cut(s) 50
HphI GGTGA 2 cut(s) 128, 525
Hpy166II GTNNAC 1 cut(s) 644
Hpy188I TCNGA 5 cut(s) 211, 454, 462, 597, 612
Hpy188III TCNNGA 3 cut(s) 201, 227, 499
Hpy8I GTNNAC 1 cut(s) 644
Hpy99I CGWCG 1 cut(s) 418
HpyAV CCTTC 3 cut(s) 93, 344, 449
HpyCH4III ACNGT 3 cut(s) 104, 207, 476
HpyCH4IV ACGT 2 cut(s) 393, 640
HpyCH4V TGCA 5 cut(s) 56, 140, 391, 401, 445
HpyF10VI GCNNNNNNNGC 2 cut(s) 146, 439
HpyF3I CTNAG 2 cut(s) 25, 242
HpySE526I ACGT 2 cut(s) 393, 640
Hsp92I GRCGYC 1 cut(s) 79
Hsp92II CATG 3 cut(s) 130, 277, 424
HspAI GCGC 1 cut(s) 79
KasI GGCGCC 1 cut(s) 78
Kzo9I GATC 4 cut(s) 46, 353, 357, 556
LmnI GCTCC 2 cut(s) 302, 613
LpnPI CCDG 7 cut(s) 63, 99, 186, 501, 512, 528, 538
Lsp1109I GCAGC 2 cut(s) 180, 429
LweI GCATC 4 cut(s) 127, 558, 573, 588
MaeI CTAG 2 cut(s) 162, 236
MaeII ACGT 2 cut(s) 393, 640
MaeIII GTNAC 1 cut(s) 470
MalI GATC 4 cut(s) 48, 355, 359, 558
MbiI CCGCTC 2 cut(s) 593, 608
MboI GATC 4 cut(s) 46, 353, 357, 556
MboII GAAGA 3 cut(s) 87, 131, 436
MhlI GDGCHC 1 cut(s) 263
Mly113I GGCGCC 1 cut(s) 79
MlyI GAGTC 2 cut(s) 116, 239
MmeI TCCRAC 2 cut(s) 294, 440
MseI TTAA 1 cut(s) 369
MspCI CTTAAG 1 cut(s) 368
MspI CCGG 1 cut(s) 50
MspR9I CCNGG 1 cut(s) 516
MvaI CCWGG 1 cut(s) 516
MvnI CGCG 1 cut(s) 61
MwoI GCNNNNNNNGC 2 cut(s) 146, 439
NarI GGCGCC 1 cut(s) 79
NdeII GATC 4 cut(s) 46, 353, 357, 556
NlaIII CATG 3 cut(s) 130, 277, 424
NlaIV GGNNCC 3 cut(s) 80, 167, 506
NmuCI GTSAC 1 cut(s) 470
PceI AGGCCT 1 cut(s) 548
PfeI GAWTC 3 cut(s) 311, 449, 463
PflMI CCANNNNNTGG 1 cut(s) 629
PkrI GCNGC 3 cut(s) 195, 444, 490
PleI GAGTC 2 cut(s) 116, 238
PluTI GGCGCC 1 cut(s) 82
PmaCI CACGTG 2 cut(s) 394, 641
PmlI CACGTG 2 cut(s) 394, 641
PpsI GAGTC 2 cut(s) 116, 238
Ppu21I YACGTR 2 cut(s) 394, 641
Psp6I CCWGG 1 cut(s) 514
PspCI CACGTG 2 cut(s) 394, 641
PspGI CCWGG 1 cut(s) 514
PspN4I GGNNCC 3 cut(s) 80, 167, 506
PspPI GGNCC 3 cut(s) 104, 207, 277
RsaI GTAC 1 cut(s) 374
RsaNI GTAC 1 cut(s) 373
Rsr2I CGGWCCG 1 cut(s) 207
RsrII CGGWCCG 1 cut(s) 207
SaqAI TTAA 1 cut(s) 369
SatI GCNGC 3 cut(s) 194, 443, 489
Sau3AI GATC 4 cut(s) 46, 353, 357, 556
Sau96I GGNCC 3 cut(s) 104, 207, 277
SchI GAGTC 2 cut(s) 116, 239
ScrFI CCNGG 1 cut(s) 516
SduI GDGCHC 1 cut(s) 263
SfaNI GCATC 4 cut(s) 127, 558, 573, 588
SfoI GGCGCC 1 cut(s) 80
SinI GGWCC 2 cut(s) 104, 207
SmlI CTYRAG 2 cut(s) 338, 368
SmoI CTYRAG 2 cut(s) 338, 368
SseBI AGGCCT 1 cut(s) 548
SsiI CCGC 6 cut(s) 59, 257, 488, 576, 591, 606
SspDI GGCGCC 1 cut(s) 78
SspMI CTAG 2 cut(s) 162, 236
StuI AGGCCT 1 cut(s) 548
StyD4I CCNGG 1 cut(s) 514
TaaI ACNGT 3 cut(s) 104, 207, 476
TaiI ACGT 2 cut(s) 396, 643
TaqI TCGA 5 cut(s) 14, 356, 413, 551, 581
TauI GCSGC 1 cut(s) 491
TfiI GAWTC 3 cut(s) 311, 449, 463
Tru1I TTAA 1 cut(s) 369
Tru9I TTAA 1 cut(s) 369
TscAI CASTG 2 cut(s) 49, 257
TseFI GTSAC 1 cut(s) 470
TseI GCWGC 2 cut(s) 193, 442
Tsp45I GTSAC 1 cut(s) 470
TspDTI ATGAA 2 cut(s) 363, 437
TspGWI ACGGA 1 cut(s) 149
TspRI CASTG 2 cut(s) 49, 257
Van91I CCANNNNNTGG 1 cut(s) 629
Vha464I CTTAAG 1 cut(s) 368
VpaK11BI GGWCC 2 cut(s) 104, 207
XagI CCTNNNNNAGG 1 cut(s) 111
XspI CTAG 2 cut(s) 162, 236
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.