pycom11g16230

Nudix hydrolase 3-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr11
Physical Location & Seq
Forward (+)
17770401 .. 17781443
11043 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 495 bp
ATGATGACGGATGCAACAACAGCTACGATAGTAGCAAGGAACCTCCTTACTCCTAAAGATAGTAGGCTGCTTTCAGGATGGTCCGATGAGTTGGCCGTTCAAGAGTCCCTCGCTCTCACTGTTCAGTGTGCAGGCTCTGTGTCCAACATGGGCCAACGCCTACTTGCTCGCTCCCGTCAGGTTGAATCGTTGATGGCAGAGGTGGAAAGTCTCAAGCAAGAGATCAAACAGCTTAAGCACGAGAATAGAGGTTTGCACATGCTTGCCAACAATTATTCGACGGGCATGAAGAGGAAGCTTGATGAGCTGCAAGAATCTGAAGGTCGGATTCAAAGTGACCGTCAAAGGCTTGCTGCTTATCTCCAGAGGCACCTTTTTCCTGGGTCATCCAGCGTTCCACCAAGTATTGTGGCCTCGAACGATCTAGCTCCGATGCCTCCCGCTTCGATGCCTCTCACTCCGATTTCCTCATACGTACAAGACAAAGAGAATTGA

Protein Analysis

165

Amino Acids

18.11

Weight (kDa)

6.84

Isoelectric Point (pI)

55.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 369
AciI CCGC 1 cut(s) 441
AcoI YGGCCR 1 cut(s) 93
AcuI CTGAAG 1 cut(s) 339
AfaI GTAC 1 cut(s) 477
AflII CTTAAG 1 cut(s) 233
AgsI TTSAA 3 cut(s) 101, 185, 332
AjnI CCWGG 1 cut(s) 379
AluBI AGCT 5 cut(s) 23, 232, 298, 307, 428
AluI AGCT 5 cut(s) 23, 232, 298, 307, 428
Alw26I GTCTC 1 cut(s) 215
AlwNI CAGNNNCTG 1 cut(s) 137
AoxI GGCC 3 cut(s) 93, 151, 411
ApeKI GCWGC 3 cut(s) 67, 307, 353
ArsI GACNNNNNNTTYG 2 cut(s) 325, 357
AspS9I GGNCC 2 cut(s) 81, 151
AvaII GGWCC 1 cut(s) 81
BanI GGYRCC 1 cut(s) 369
BauI CACGAG 1 cut(s) 239
BbvI GCAGC 3 cut(s) 54, 294, 340
BccI CCATC 2 cut(s) 72, 187
BceAI ACGGC 1 cut(s) 80
BciT130I CCWGG 1 cut(s) 381
BcoDI GTCTC 1 cut(s) 215
BfaI CTAG 1 cut(s) 425
BfrI CTTAAG 1 cut(s) 233
BisI GCNGC 3 cut(s) 68, 308, 354
BlsI GCNGC 3 cut(s) 69, 309, 355
Bme1390I CCNGG 1 cut(s) 381
Bme18I GGWCC 1 cut(s) 81
BmgT120I GGNCC 2 cut(s) 81, 151
BmiI GGNNCC 2 cut(s) 41, 371
BmrFI CCNGG 1 cut(s) 381
BmsI GCATC 2 cut(s) 423, 438
BpmI CTGGAG 1 cut(s) 347
BpuEI CTTGAG 1 cut(s) 197
BsaAI YACGTR 1 cut(s) 475
BsaJI CCNNGG 1 cut(s) 380
BseBI CCWGG 1 cut(s) 381
BseDI CCNNGG 1 cut(s) 380
BseGI GGATG 3 cut(s) 16, 83, 386
BseXI GCAGC 3 cut(s) 54, 294, 340
BsgI GTGCAG 1 cut(s) 150
BshFI GGCC 3 cut(s) 95, 153, 413
BshNI GGYRCC 1 cut(s) 369
BslFI GGGAC 1 cut(s) 91
BsmAI GTCTC 1 cut(s) 215
BsmFI GGGAC 1 cut(s) 91
BsnI GGCC 3 cut(s) 95, 153, 413
Bsp143I GATC 2 cut(s) 222, 421
BspACI CCGC 1 cut(s) 441
BspANI GGCC 3 cut(s) 95, 153, 413
BspLI GGNNCC 2 cut(s) 41, 371
BspT107I GGYRCC 1 cut(s) 369
BspTI CTTAAG 1 cut(s) 233
BssECI CCNNGG 1 cut(s) 380
BssMI GATC 2 cut(s) 222, 421
BssSI CACGAG 1 cut(s) 239
Bst2BI CACGAG 1 cut(s) 239
Bst2UI CCWGG 1 cut(s) 381
Bst4CI ACNGT 2 cut(s) 121, 341
Bst6I CTCTTC 1 cut(s) 284
BstAFI CTTAAG 1 cut(s) 233
BstBAI YACGTR 1 cut(s) 475
BstC8I GCNNGC 4 cut(s) 133, 169, 264, 351
BstF5I GGATG 3 cut(s) 16, 83, 386
BstKTI GATC 2 cut(s) 225, 424
BstMAI GTCTC 1 cut(s) 215
BstMBI GATC 2 cut(s) 222, 421
BstMWI GCNNNNNNNGC 2 cut(s) 20, 304
BstNI CCWGG 1 cut(s) 381
BstNSI RCATGY 1 cut(s) 262
BstSCI CCNGG 1 cut(s) 379
BstSNI TACGTA 1 cut(s) 475
BstV1I GCAGC 3 cut(s) 54, 294, 340
BsuRI GGCC 3 cut(s) 95, 153, 413
BtsCI GGATG 3 cut(s) 16, 83, 386
BtsIMutI CAGTG 2 cut(s) 117, 131
Cac8I GCNNGC 4 cut(s) 133, 169, 264, 351
CaiI CAGNNNCTG 1 cut(s) 137
Cfr13I GGNCC 2 cut(s) 81, 151
Csp6I GTAC 1 cut(s) 476
CspCI CAANNNNNGTGG 2 cut(s) 390, 425
CviAII CATG 3 cut(s) 148, 259, 286
CviQI GTAC 1 cut(s) 476
DpnI GATC 2 cut(s) 224, 423
DpnII GATC 2 cut(s) 222, 421
EaeI YGGCCR 1 cut(s) 93
Eam1104I CTCTTC 1 cut(s) 284
EarI CTCTTC 1 cut(s) 284
Eco105I TACGTA 1 cut(s) 475
Eco47I GGWCC 1 cut(s) 81
Eco57I CTGAAG 1 cut(s) 339
EcoRII CCWGG 1 cut(s) 379
FaeI CATG 3 cut(s) 151, 262, 289
FaiI YATR 4 cut(s) 149, 260, 287, 472
FaqI GGGAC 1 cut(s) 91
FatI CATG 3 cut(s) 147, 258, 285
FauI CCCGC 1 cut(s) 448
Fnu4HI GCNGC 3 cut(s) 68, 308, 354
FokI GGATG 3 cut(s) 23, 90, 373
Fsp4HI GCNGC 3 cut(s) 68, 308, 354
FspBI CTAG 1 cut(s) 425
GluI GCNGC 3 cut(s) 68, 308, 354
GsuI CTGGAG 1 cut(s) 347
HaeIII GGCC 3 cut(s) 95, 153, 413
Hin1II CATG 3 cut(s) 151, 262, 289
HindIII AAGCTT 1 cut(s) 296
HinfI GANTC 4 cut(s) 104, 185, 314, 328
Hpy188I TCNGA 5 cut(s) 85, 319, 327, 432, 462
Hpy188III TCNNGA 3 cut(s) 75, 101, 364
Hpy99I CGWCG 1 cut(s) 283
HpyAV CCTTC 1 cut(s) 314
HpyCH4III ACNGT 2 cut(s) 121, 341
HpyCH4IV ACGT 1 cut(s) 474
HpyCH4V TGCA 4 cut(s) 14, 131, 256, 310
HpyF10VI GCNNNNNNNGC 2 cut(s) 20, 304
HpySE526I ACGT 1 cut(s) 474
Hsp92II CATG 3 cut(s) 151, 262, 289
Kzo9I GATC 2 cut(s) 222, 421
LmnI GCTCC 2 cut(s) 176, 433
LpnPI CCDG 7 cut(s) 60, 117, 164, 366, 377, 393, 403
Lsp1109I GCAGC 3 cut(s) 54, 294, 340
LweI GCATC 2 cut(s) 423, 438
MaeI CTAG 1 cut(s) 425
MaeII ACGT 1 cut(s) 474
MaeIII GTNAC 1 cut(s) 335
MalI GATC 2 cut(s) 224, 423
MboI GATC 2 cut(s) 222, 421
MboII GAAGA 1 cut(s) 301
MluCI AATT 2 cut(s) 271, 490
MlyI GAGTC 1 cut(s) 113
MmeI TCCRAC 2 cut(s) 168, 305
MseI TTAA 1 cut(s) 234
MspCI CTTAAG 1 cut(s) 233
MspR9I CCNGG 1 cut(s) 381
MvaI CCWGG 1 cut(s) 381
MwoI GCNNNNNNNGC 2 cut(s) 20, 304
NdeII GATC 2 cut(s) 222, 421
NlaIII CATG 3 cut(s) 151, 262, 289
NlaIV GGNNCC 2 cut(s) 41, 371
NmuCI GTSAC 1 cut(s) 335
NspI RCATGY 1 cut(s) 262
PfeI GAWTC 3 cut(s) 185, 314, 328
PkrI GCNGC 3 cut(s) 69, 309, 355
PleI GAGTC 1 cut(s) 112
PpsI GAGTC 1 cut(s) 112
Ppu21I YACGTR 1 cut(s) 475
Psp6I CCWGG 1 cut(s) 379
PspGI CCWGG 1 cut(s) 379
PspN4I GGNNCC 2 cut(s) 41, 371
PspPI GGNCC 2 cut(s) 81, 151
PstNI CAGNNNCTG 1 cut(s) 137
RsaI GTAC 1 cut(s) 477
RsaNI GTAC 1 cut(s) 476
SaqAI TTAA 1 cut(s) 234
SatI GCNGC 3 cut(s) 68, 308, 354
Sau3AI GATC 2 cut(s) 222, 421
Sau96I GGNCC 2 cut(s) 81, 151
SchI GAGTC 1 cut(s) 113
ScrFI CCNGG 1 cut(s) 381
SfaNI GCATC 2 cut(s) 423, 438
SinI GGWCC 1 cut(s) 81
SmlI CTYRAG 2 cut(s) 212, 233
SmoI CTYRAG 2 cut(s) 212, 233
SnaBI TACGTA 1 cut(s) 475
Sse9I AATT 2 cut(s) 271, 490
SsiI CCGC 1 cut(s) 441
SspMI CTAG 1 cut(s) 425
StyD4I CCNGG 1 cut(s) 379
TaaI ACNGT 2 cut(s) 121, 341
TaiI ACGT 1 cut(s) 477
TaqI TCGA 3 cut(s) 278, 416, 446
TasI AATT 2 cut(s) 271, 490
TfiI GAWTC 3 cut(s) 185, 314, 328
Tru1I TTAA 1 cut(s) 234
Tru9I TTAA 1 cut(s) 234
TscAI CASTG 2 cut(s) 124, 131
TseFI GTSAC 1 cut(s) 335
TseI GCWGC 3 cut(s) 67, 307, 353
Tsp45I GTSAC 1 cut(s) 335
TspDTI ATGAA 1 cut(s) 302
TspGWI ACGGA 1 cut(s) 23
TspRI CASTG 2 cut(s) 124, 131
Vha464I CTTAAG 1 cut(s) 233
VpaK11BI GGWCC 1 cut(s) 81
XceI RCATGY 1 cut(s) 262
XspI CTAG 1 cut(s) 425
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.