pycom11g20110

Zinc finger MYM-type protein 1-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr11
Physical Location & Seq
Reverse (-)
22649543 .. 22650130
588 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 462 bp
ATGTGGTTAATGATTCAGGCACCCAAAATGGAATTTAAACTATTACCGGATCATTTCAAGTATCACCGCCCATTCAAAGATAAATTCCATGCCAAAGATACTAAACATGGAGAAAGGTGGAGCTTCACAAAGGTTGTTTACGTGAAGCCCCACTACGAGGCGCAGAAGCGGAAGACGGGAGGCATCGGAGCTAGAGCATTCCAGGCCTCAATACTTGGCCAAGCGCTGGATGACCAGGAAAAAGGTGCCTCTGGAGATAAGACGCAAGCCTTTGACGGTCACTGTGAATTCGACCCTCAGATTCTTGCAGCTCATCAAGCTTCCTTTCATCCCCGACGAATAGTTATTTGCAAGCACATGCAAACTTCTATTCTCGTACTTAAGCTGCTGGATCTCTTGCTTAAGTCTTTCCACCTCTGCCATCAACGATTCCACCTGACGGGAGCGGGCAAGCAGGCGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

154

Amino Acids

17.6

Weight (kDa)

9.68

Isoelectric Point (pI)

24.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 19, 245
AccB7I CCANNNNNTGG 1 cut(s) 226
AccBSI CCGCTC 1 cut(s) 446
AciI CCGC 3 cut(s) 67, 169, 446
AclWI GGATC 2 cut(s) 57, 399
AcoI YGGCCR 1 cut(s) 217
AcsI RAATTY 3 cut(s) 32, 83, 287
AfaI GTAC 1 cut(s) 378
AfeI AGCGCT 1 cut(s) 225
AfiI CCNNNNNNNGG 3 cut(s) 157, 226, 439
AflII CTTAAG 2 cut(s) 380, 401
AgsI TTSAA 2 cut(s) 58, 76
AjnI CCWGG 2 cut(s) 201, 234
AluBI AGCT 5 cut(s) 123, 191, 311, 320, 385
AluI AGCT 5 cut(s) 123, 191, 311, 320, 385
AlwI GGATC 2 cut(s) 57, 399
Aor51HI AGCGCT 1 cut(s) 225
AoxI GGCC 2 cut(s) 204, 217
ApeKI GCWGC 2 cut(s) 308, 385
ApoI RAATTY 3 cut(s) 32, 83, 287
AspLEI GCGC 2 cut(s) 163, 226
AsuHPI GGTGA 1 cut(s) 56
BalI TGGCCA 1 cut(s) 219
BanI GGYRCC 2 cut(s) 19, 245
BarI GAAGNNNNNNTAC 2 cut(s) 137, 169
BbsI GAAGAC 1 cut(s) 179
BbvI GCAGC 2 cut(s) 320, 372
BccI CCATC 1 cut(s) 429
BciT130I CCWGG 2 cut(s) 203, 236
BfaI CTAG 1 cut(s) 192
BfoI RGCGCY 1 cut(s) 227
BfrI CTTAAG 2 cut(s) 380, 401
BisI GCNGC 2 cut(s) 309, 386
BlsI GCNGC 2 cut(s) 310, 387
Bme1390I CCNGG 2 cut(s) 203, 236
BmiI GGNNCC 2 cut(s) 21, 247
BmrFI CCNGG 2 cut(s) 203, 236
BmsI GCATC 1 cut(s) 192
BpiI GAAGAC 1 cut(s) 179
BpmI CTGGAG 1 cut(s) 273
BsaAI YACGTR 1 cut(s) 142
BsaWI WCCGGW 1 cut(s) 46
Bsc4I CCNNNNNNNGG 3 cut(s) 157, 226, 439
BseBI CCWGG 2 cut(s) 203, 236
BseGI GGATG 2 cut(s) 235, 328
BseLI CCNNNNNNNGG 3 cut(s) 157, 226, 439
BseMII CTCAG 1 cut(s) 311
BseXI GCAGC 2 cut(s) 320, 372
BshFI GGCC 2 cut(s) 206, 219
BshNI GGYRCC 2 cut(s) 19, 245
BsiSI CCGG 1 cut(s) 47
BslI CCNNNNNNNGG 3 cut(s) 157, 226, 439
BsmI GAATGC 1 cut(s) 197
BsnI GGCC 2 cut(s) 206, 219
Bsp143I GATC 2 cut(s) 49, 391
BspACI CCGC 3 cut(s) 67, 169, 446
BspANI GGCC 2 cut(s) 206, 219
BspCNI CTCAG 1 cut(s) 310
BspLI GGNNCC 2 cut(s) 21, 247
BspPI GGATC 2 cut(s) 57, 399
BspT107I GGYRCC 2 cut(s) 19, 245
BspTI CTTAAG 2 cut(s) 380, 401
BsrBI CCGCTC 1 cut(s) 446
BssMI GATC 2 cut(s) 49, 391
Bst2UI CCWGG 2 cut(s) 203, 236
Bst4CI ACNGT 2 cut(s) 278, 284
BstAFI CTTAAG 2 cut(s) 380, 401
BstBAI YACGTR 1 cut(s) 142
BstC8I GCNNGC 5 cut(s) 267, 353, 448, 452, 456
BstDEI CTNAG 1 cut(s) 297
BstF5I GGATG 2 cut(s) 235, 328
BstH2I RGCGCY 1 cut(s) 227
BstHHI GCGC 2 cut(s) 163, 226
BstKTI GATC 2 cut(s) 52, 394
BstMBI GATC 2 cut(s) 49, 391
BstMWI GCNNNNNNNGC 2 cut(s) 203, 317
BstNI CCWGG 2 cut(s) 203, 236
BstNSI RCATGY 1 cut(s) 361
BstSCI CCNGG 2 cut(s) 201, 234
BstV1I GCAGC 2 cut(s) 320, 372
BstV2I GAAGAC 1 cut(s) 179
BstX2I RGATCY 1 cut(s) 391
BstYI RGATCY 1 cut(s) 391
BsuRI GGCC 2 cut(s) 206, 219
BtsCI GGATG 2 cut(s) 235, 328
BtsIMutI CAGTG 1 cut(s) 280
Cac8I GCNNGC 5 cut(s) 267, 353, 448, 452, 456
CfoI GCGC 2 cut(s) 163, 226
CseI GACGC 1 cut(s) 271
Csp6I GTAC 1 cut(s) 377
CviAII CATG 3 cut(s) 89, 107, 358
CviJI RGCY 9 cut(s) 123, 148, 191, 206, 219, 269, 311, 320, 385
CviKI_1 RGCY 9 cut(s) 123, 148, 191, 206, 219, 269, 311, 320, 385
CviQI GTAC 1 cut(s) 377
DdeI CTNAG 1 cut(s) 297
DpnI GATC 2 cut(s) 51, 393
DpnII GATC 2 cut(s) 49, 391
DraI TTTAAA 1 cut(s) 37
EaeI YGGCCR 1 cut(s) 217
Eco147I AGGCCT 1 cut(s) 206
Eco47III AGCGCT 1 cut(s) 225
EcoRI GAATTC 1 cut(s) 287
EcoRII CCWGG 2 cut(s) 201, 234
FaeI CATG 3 cut(s) 92, 110, 361
FaiI YATR 3 cut(s) 90, 108, 359
FatI CATG 3 cut(s) 88, 106, 357
FauI CCCGC 1 cut(s) 439
Fnu4HI GCNGC 2 cut(s) 309, 386
FokI GGATG 2 cut(s) 242, 315
Fsp4HI GCNGC 2 cut(s) 309, 386
FspBI CTAG 1 cut(s) 192
GlaI GCGC 2 cut(s) 162, 225
GluI GCNGC 2 cut(s) 309, 386
GsuI CTGGAG 1 cut(s) 273
HaeII RGCGCY 1 cut(s) 227
HaeIII GGCC 2 cut(s) 206, 219
HapII CCGG 1 cut(s) 47
HgaI GACGC 1 cut(s) 271
HhaI GCGC 2 cut(s) 163, 226
Hin1II CATG 3 cut(s) 92, 110, 361
Hin6I GCGC 2 cut(s) 161, 224
HinP1I GCGC 2 cut(s) 161, 224
HindIII AAGCTT 1 cut(s) 318
HinfI GANTC 3 cut(s) 13, 301, 429
HpaII CCGG 1 cut(s) 47
HphI GGTGA 1 cut(s) 56
Hpy166II GTNNAC 1 cut(s) 139
Hpy188I TCNGA 2 cut(s) 188, 300
Hpy188III TCNNGA 1 cut(s) 252
Hpy8I GTNNAC 1 cut(s) 139
Hpy99I CGWCG 1 cut(s) 339
HpyCH4III ACNGT 2 cut(s) 278, 284
HpyCH4IV ACGT 1 cut(s) 141
HpyCH4V TGCA 3 cut(s) 308, 351, 361
HpyF10VI GCNNNNNNNGC 2 cut(s) 203, 317
HpyF3I CTNAG 1 cut(s) 297
HpySE526I ACGT 1 cut(s) 141
Hsp92II CATG 3 cut(s) 92, 110, 361
HspAI GCGC 2 cut(s) 161, 224
Kzo9I GATC 2 cut(s) 49, 391
LmnI GCTCC 3 cut(s) 120, 188, 443
Lsp1109I GCAGC 2 cut(s) 320, 372
LweI GCATC 1 cut(s) 192
MaeI CTAG 1 cut(s) 192
MaeII ACGT 1 cut(s) 141
MaeIII GTNAC 1 cut(s) 278
MalI GATC 2 cut(s) 51, 393
MbiI CCGCTC 1 cut(s) 446
MboI GATC 2 cut(s) 49, 391
MboII GAAGA 1 cut(s) 184
MflI RGATCY 1 cut(s) 391
MlsI TGGCCA 1 cut(s) 219
MluCI AATT 3 cut(s) 32, 83, 287
MluNI TGGCCA 1 cut(s) 219
MnlI CCTC 6 cut(s) 151, 173, 217, 259, 306, 425
Mox20I TGGCCA 1 cut(s) 219
MscI TGGCCA 1 cut(s) 219
MseI TTAA 4 cut(s) 8, 36, 381, 402
Msp20I TGGCCA 1 cut(s) 219
MspCI CTTAAG 2 cut(s) 380, 401
MspI CCGG 1 cut(s) 47
MspR9I CCNGG 2 cut(s) 203, 236
Mva1269I GAATGC 1 cut(s) 197
MvaI CCWGG 2 cut(s) 203, 236
MwoI GCNNNNNNNGC 2 cut(s) 203, 317
NdeII GATC 2 cut(s) 49, 391
NlaIII CATG 3 cut(s) 92, 110, 361
NlaIV GGNNCC 2 cut(s) 21, 247
NmuCI GTSAC 1 cut(s) 278
NspI RCATGY 1 cut(s) 361
PceI AGGCCT 1 cut(s) 206
PctI GAATGC 1 cut(s) 197
PfeI GAWTC 3 cut(s) 13, 301, 429
PflMI CCANNNNNTGG 1 cut(s) 226
PkrI GCNGC 2 cut(s) 310, 387
Ppu21I YACGTR 1 cut(s) 142
Psp6I CCWGG 2 cut(s) 201, 234
PspGI CCWGG 2 cut(s) 201, 234
PspN4I GGNNCC 2 cut(s) 21, 247
PsuI RGATCY 1 cut(s) 391
RsaI GTAC 1 cut(s) 378
RsaNI GTAC 1 cut(s) 377
SaqAI TTAA 4 cut(s) 8, 36, 381, 402
SatI GCNGC 2 cut(s) 309, 386
Sau3AI GATC 2 cut(s) 49, 391
ScrFI CCNGG 2 cut(s) 203, 236
SfaNI GCATC 1 cut(s) 192
SmlI CTYRAG 2 cut(s) 380, 401
SmoI CTYRAG 2 cut(s) 380, 401
Sse9I AATT 3 cut(s) 32, 83, 287
SseBI AGGCCT 1 cut(s) 206
SsiI CCGC 3 cut(s) 67, 169, 446
SspMI CTAG 1 cut(s) 192
StuI AGGCCT 1 cut(s) 206
StyD4I CCNGG 2 cut(s) 201, 234
TaaI ACNGT 2 cut(s) 278, 284
TaiI ACGT 1 cut(s) 144
TaqI TCGA 1 cut(s) 291
TasI AATT 3 cut(s) 32, 83, 287
TfiI GAWTC 3 cut(s) 13, 301, 429
Tru1I TTAA 4 cut(s) 8, 36, 381, 402
Tru9I TTAA 4 cut(s) 8, 36, 381, 402
TscAI CASTG 1 cut(s) 287
TseFI GTSAC 1 cut(s) 278
TseI GCWGC 2 cut(s) 308, 385
Tsp45I GTSAC 1 cut(s) 278
TspDTI ATGAA 1 cut(s) 317
TspRI CASTG 1 cut(s) 287
Van91I CCANNNNNTGG 1 cut(s) 226
Vha464I CTTAAG 2 cut(s) 380, 401
XapI RAATTY 3 cut(s) 32, 83, 287
XceI RCATGY 1 cut(s) 361
XspI CTAG 1 cut(s) 192
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.