pycom1236g00020

meprin and TRAF homology

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00001236
Physical Location & Seq
Reverse (-)
81953 .. 82571
619 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 561 bp
AATTATAATCAAAAGCTTAACGAATTAATTTGTTTGGTGCAGGGCTCACAAAATCAAGACAATGAGGTTCGACAAGAAGACAAAAGGTTGGACCACTTGGAAAAGCAAATTGGGCAGATAGCGGAGTTCGTAGGACAATTTTGCGACCAAGGGAAACTCCCTAGTTCAACCATTGTAAATCCGAAGGGAGGATTTGAAGCACCTTTGTCAGAAGCACTTATTGCTCCTACGCCATCTAATTCAAGTAAGGTTGTTCCAATTAGTTCTAACCCCATTCCAACAAATATCCCTATTCCTTGCAGGTTCATGAATTCCAAGGAAGAAGAAAGTGAAAAAGACATCTTGGAAGCCCTTCCAAAGGTGCAAAGTAGGGAATGTCATGAATTCATCAAAGAGGACGTTCTTGAAACCACAAAATCCAAAGAAGTTAAATTTGATGACATTGGACAAGTCATAACCATCACTTGCAATCTGGCCAAGTCCAATATCCCTGAAACTTTGAAAGGAATGGTGTTTGTCATTGAGTTCTTATCGGACAAAACAAGTAAGCACCTACACTAG

Protein Analysis

187

Amino Acids

20.81

Weight (kDa)

5.19

Isoelectric Point (pI)

46.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 6
Acc36I ACCTGC 1 cut(s) 291
AciI CCGC 1 cut(s) 122
AcoI YGGCCR 1 cut(s) 474
AcsI RAATTY 3 cut(s) 310, 383, 431
AfiI CCNNNNNNNGG 2 cut(s) 188, 358
AgsI TTSAA 5 cut(s) 168, 197, 243, 407, 502
AjuI GAANNNNNNNTTGG 2 cut(s) 93, 125
AluBI AGCT 1 cut(s) 16
AluI AGCT 1 cut(s) 16
AoxI GGCC 1 cut(s) 474
ApoI RAATTY 3 cut(s) 310, 383, 431
AseI ATTAAT 1 cut(s) 26
Asp700I GAANNNNTTC 1 cut(s) 351
AspS9I GGNCC 1 cut(s) 91
AvaII GGWCC 1 cut(s) 91
BalI TGGCCA 1 cut(s) 476
BanII GRGCYC 1 cut(s) 47
BbsI GAAGAC 1 cut(s) 84
BccI CCATC 2 cut(s) 241, 467
BfaI CTAG 2 cut(s) 162, 559
BfuAI ACCTGC 1 cut(s) 291
Bme18I GGWCC 1 cut(s) 91
BmgT120I GGNCC 1 cut(s) 91
BpiI GAAGAC 1 cut(s) 84
BsaJI CCNNGG 2 cut(s) 148, 315
Bsc4I CCNNNNNNNGG 2 cut(s) 188, 358
BseDI CCNNGG 2 cut(s) 148, 315
BseLI CCNNNNNNNGG 2 cut(s) 188, 358
BsgI GTGCAG 1 cut(s) 59
BshFI GGCC 1 cut(s) 476
BslI CCNNNNNNNGG 2 cut(s) 188, 358
BsnI GGCC 1 cut(s) 476
Bsp1286I GDGCHC 1 cut(s) 47
BspACI CCGC 1 cut(s) 122
BspANI GGCC 1 cut(s) 476
BspHI TCATGA 2 cut(s) 306, 379
BspMI ACCTGC 1 cut(s) 291
BssECI CCNNGG 2 cut(s) 148, 315
BssT1I CCWWGG 2 cut(s) 148, 315
BstAPI GCANNNNNTGC 1 cut(s) 221
BstENI CCTNNNNNAGG 1 cut(s) 356
BstMWI GCNNNNNNNGC 2 cut(s) 112, 221
BstV2I GAAGAC 1 cut(s) 84
BsuRI GGCC 1 cut(s) 476
BveI ACCTGC 1 cut(s) 291
CciI TCATGA 2 cut(s) 306, 379
Cfr13I GGNCC 1 cut(s) 91
CviAII CATG 2 cut(s) 307, 380
CviJI RGCY 4 cut(s) 16, 45, 350, 476
CviKI_1 RGCY 4 cut(s) 16, 45, 350, 476
EaeI YGGCCR 1 cut(s) 474
Eco130I CCWWGG 2 cut(s) 148, 315
Eco24I GRGCYC 1 cut(s) 47
Eco47I GGWCC 1 cut(s) 91
EcoNI CCTNNNNNAGG 1 cut(s) 356
EcoRI GAATTC 2 cut(s) 310, 383
EcoT14I CCWWGG 2 cut(s) 148, 315
EcoT38I GRGCYC 1 cut(s) 47
ErhI CCWWGG 2 cut(s) 148, 315
FaeI CATG 2 cut(s) 310, 383
FaiI YATR 4 cut(s) 6, 308, 381, 455
FatI CATG 2 cut(s) 306, 379
FriOI GRGCYC 1 cut(s) 47
FspBI CTAG 2 cut(s) 162, 559
HaeIII GGCC 1 cut(s) 476
Hin1II CATG 2 cut(s) 310, 383
HindIII AAGCTT 1 cut(s) 14
Hpy188I TCNGA 3 cut(s) 183, 211, 535
Hpy188III TCNNGA 4 cut(s) 56, 307, 380, 404
HpyAV CCTTC 2 cut(s) 178, 362
HpyCH4IV ACGT 1 cut(s) 399
HpyCH4V TGCA 4 cut(s) 40, 300, 364, 468
HpyF10VI GCNNNNNNNGC 2 cut(s) 112, 221
HpySE526I ACGT 1 cut(s) 399
Hsp92II CATG 2 cut(s) 310, 383
LmnI GCTCC 1 cut(s) 229
LpnPI CCDG 4 cut(s) 26, 286, 458, 504
MaeI CTAG 2 cut(s) 162, 559
MaeII ACGT 1 cut(s) 399
MboII GAAGA 3 cut(s) 89, 332, 335
MhlI GDGCHC 1 cut(s) 47
MlsI TGGCCA 1 cut(s) 476
MluCI AATT 9 cut(s) 23, 27, 108, 137, 238, 258, 310, 383, 431
MluNI TGGCCA 1 cut(s) 476
MmeI TCCRAC 2 cut(s) 69, 302
MnlI CCTC 3 cut(s) 58, 182, 388
Mox20I TGGCCA 1 cut(s) 476
MroXI GAANNNNTTC 1 cut(s) 351
MscI TGGCCA 1 cut(s) 476
MseI TTAA 3 cut(s) 18, 26, 429
Msp20I TGGCCA 1 cut(s) 476
MwoI GCNNNNNNNGC 2 cut(s) 112, 221
NlaIII CATG 2 cut(s) 310, 383
PagI TCATGA 2 cut(s) 306, 379
PdmI GAANNNNTTC 1 cut(s) 351
PshBI ATTAAT 1 cut(s) 26
PsiI TTATAA 1 cut(s) 6
PspPI GGNCC 1 cut(s) 91
SaqAI TTAA 3 cut(s) 18, 26, 429
Sau96I GGNCC 1 cut(s) 91
SduI GDGCHC 1 cut(s) 47
SetI ASST 9 cut(s) 18, 69, 89, 205, 252, 305, 363, 402, 555
SinI GGWCC 1 cut(s) 91
Sse9I AATT 9 cut(s) 23, 27, 108, 137, 238, 258, 310, 383, 431
SsiI CCGC 1 cut(s) 122
SspMI CTAG 2 cut(s) 162, 559
StyI CCWWGG 2 cut(s) 148, 315
TaiI ACGT 1 cut(s) 402
TaqI TCGA 1 cut(s) 70
TasI AATT 9 cut(s) 23, 27, 108, 137, 238, 258, 310, 383, 431
Tru1I TTAA 3 cut(s) 18, 26, 429
Tru9I TTAA 3 cut(s) 18, 26, 429
TspDTI ATGAA 4 cut(s) 295, 323, 376, 396
VpaK11BI GGWCC 1 cut(s) 91
VspI ATTAAT 1 cut(s) 26
XagI CCTNNNNNAGG 1 cut(s) 356
XapI RAATTY 3 cut(s) 310, 383, 431
XmnI GAANNNNTTC 1 cut(s) 351
XspI CTAG 2 cut(s) 162, 559
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.