pycom12426g00290

transposition, RNA-mediated

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00012426
Physical Location & Seq
Forward (+)
151657 .. 153850
2194 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 1698 bp
ATGAACTTATATTCACAAGTAGTGGAGGTTGCTTATAAACAATCGCTCTTGCTTGTATCTCTATTATGCAATCATGTAGGGGACTTTTTGGGGAATGTTTTGGGTTGTCGTATGCAATCATCCAATTCAATAACGTTAGGAAGATTTGAAATGAAATGCAATTGGAAATCGTTTTATTATGCAAGTATAACATATATGGAGATGAACCCCTTAGCTAGCATTCATCCATACTTTCATCATATTCATATTTACATTCTTGTCTTAGTTTGTGTTTATAAGAGTTTTGATTCAATTTGTTACACAATTTCGTCCAAATTCACTAAAGTGCTCAAAACTGCCCAGAAAGTTCTTTTGGTTTGTTTTAGTGTTTTAAGCGTTTATTTACCCCCGGTCCAGAACGATCCCTACTTACATACTTACTACAATTTGACAAAAAGAGGGTTTAATTTGTGTGCGTATAAATCTCGCATCAAATTTTGGCGCCGTTGCCGGGGATTAGCAAATTTGCTAATCTCTTGGATTGTTCATTTCTTACTAGAGAAGAACAACATGGCACTTGATAATGCTTCTGTTTTGTCACAGCTCATGGAAAGGTCCCAAATGCAAAGCATTGATATATTTGACCTTCAATCAAGGAATAACGTGTTTTCCAATACTTACAATTCGGATTGGAGTGATCATTCAACTTCTATGTGGAGGGAACCTCAAAATGTTCAACAAGAAGGATATTGGCAGCCACCTCATATTCAATATGCCCAACCAAACTCAAGTTCGTCAATAGATTATAATCAAAAGCTTAATGAATTAATTTGTTTGGTGCAGGGCTCACAAAATCAAGTCAAGGAGGGCCAAAATCAAGACAAAAGGTTGGACCACTTGGAAATGCAAATTGGGCATATCGCGGAGTTCGTAGGACAGTTTCGAGACCAAGGCGAACTCCCTAGTTCAACCATTGCAAATCCGAAGGGAGAATTTGAAACTGCCAAGGAAATCATGTTGAGAAGTGACAAAGAGGTTGGAACGGACCCTCAACCATCAAAATCAAATCACAAGGAAGAGGAATACACCCAACCCACGGCAAGGGTGGAAACACTTTTACCGGAGGCACCTATTGCTCCTATGCCATCTAATTCAGGTATGGTTGTTCCAAATTTCATTATTTTTAACCCCGTTCCAACAAATATCCCTATTCCTTGCAGATTCATGACTTCCAAGGAAGAAGAAGGTGAAAAAGACATCTTGGAACCCCTTCCAAAGGTGCAAAATAGGGAATTTCATGAAGGCATCAAAGAGGACATATTTGCAACCACAATTCCCAAGGAAGTTGGATTTTATGACACGGGACAAGTCATAACTTTCGAAGGGGTGTTTATTCTTAAGTTCTTGTCGGAACACAAAGGTAAGACGCCTCCCCGAATTTCAATTTTCTTTTATACTACTATGTTGTTAATGATTCAGGCATCCACTCTAGAATTTAAACTATTACCAGATCATTTCAAGTATCACCGCCCATTCAAAGACCAATTCCATGCCATAAAAAGAAAAATAAAAGAATGTAGCCTTCACAGAGGTTGTTTACGTGAAGCCCCACTACGAGGCATAGAAGCGGAAGCGGGAGGCATCGGAGCTAGAGCATTCCAGGCCTCAATACTTGGCCAAGCGCTGGATGACCCAGGAAAAAGGTGCCTCTGGAGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

566

Amino Acids

64.9

Weight (kDa)

7.88

Isoelectric Point (pI)

42.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 3 cut(s) 36, 276, 786
AccB1I GGYRCC 3 cut(s) 480, 1105, 1683
AccB7I CCANNNNNTGG 1 cut(s) 1663
AccII CGCG 1 cut(s) 902
AciI CCGC 4 cut(s) 902, 1507, 1607, 1613
AclI AACGTT 1 cut(s) 134
AclWI GGATC 1 cut(s) 395
AcoI YGGCCR 1 cut(s) 1654
AcsI RAATTY 8 cut(s) 314, 473, 502, 971, 1150, 1271, 1416, 1472
AcyI GRCGYC 2 cut(s) 481, 1406
AfeI AGCGCT 1 cut(s) 1662
AfiI CCNNNNNNNGG 6 cut(s) 490, 1075, 1080, 1255, 1595, 1663
AflII CTTAAG 1 cut(s) 1376
AflIII ACRYGT 1 cut(s) 642
AjnI CCWGG 2 cut(s) 1638, 1672
AjuI GAANNNNNNNTTGG 6 cut(s) 335, 367, 754, 786, 873, 905
AleI CACNNNNGTG 1 cut(s) 323
AluBI AGCT 4 cut(s) 215, 583, 796, 1628
AluI AGCT 4 cut(s) 215, 583, 796, 1628
Alw21I GWGCWC 1 cut(s) 330
Alw26I GTCTC 1 cut(s) 918
AlwI GGATC 1 cut(s) 395
Aor51HI AGCGCT 1 cut(s) 1662
AoxI GGCC 3 cut(s) 847, 1641, 1654
ApeKI GCWGC 1 cut(s) 733
ApoI RAATTY 8 cut(s) 314, 473, 502, 971, 1150, 1271, 1416, 1472
AseI ATTAAT 1 cut(s) 806
Asp700I GAANNNNTTC 1 cut(s) 1248
AspLEI GCGC 2 cut(s) 483, 1663
AspS9I GGNCC 5 cut(s) 391, 594, 847, 871, 1024
AsuC2I CCSGG 2 cut(s) 389, 491
AsuHPI GGTGA 2 cut(s) 1238, 1496
AsuII TTCGAA 1 cut(s) 1359
AsuNHI GCTAGC 1 cut(s) 215
AvaII GGWCC 4 cut(s) 391, 594, 871, 1024
BalI TGGCCA 1 cut(s) 1656
BanI GGYRCC 3 cut(s) 480, 1105, 1683
BanII GRGCYC 1 cut(s) 827
BarI GAAGNNNNNNTAC 2 cut(s) 1575, 1607
Bbv12I GWGCWC 1 cut(s) 330
BbvI GCAGC 1 cut(s) 745
BccI CCATC 2 cut(s) 1042, 1132
BceAI ACGGC 2 cut(s) 468, 1092
BciT130I CCWGG 2 cut(s) 1640, 1674
BclI TGATCA 1 cut(s) 676
BcnI CCSGG 2 cut(s) 389, 491
BcoDI GTCTC 1 cut(s) 918
BfaI CTAG 5 cut(s) 216, 536, 942, 1469, 1629
BfoI RGCGCY 2 cut(s) 484, 1664
BfrI CTTAAG 1 cut(s) 1376
BisI GCNGC 1 cut(s) 734
BlsI GCNGC 1 cut(s) 735
Bme1390I CCNGG 4 cut(s) 389, 491, 1640, 1674
Bme18I GGWCC 4 cut(s) 391, 594, 871, 1024
BmgT120I GGNCC 5 cut(s) 391, 594, 847, 871, 1024
BmiI GGNNCC 7 cut(s) 482, 596, 702, 1026, 1107, 1245, 1685
BmrFI CCNGG 4 cut(s) 389, 491, 1640, 1674
BmsI GCATC 4 cut(s) 477, 1293, 1469, 1629
BmtI GCTAGC 1 cut(s) 219
BplI GAGNNNNNCTC 2 cut(s) 688, 720
Bpu10I CCTNAGC 1 cut(s) 211
Bpu14I TTCGAA 1 cut(s) 1359
BpuEI CTTGAG 1 cut(s) 751
BpuMI CCSGG 2 cut(s) 389, 491
BsaAI YACGTR 1 cut(s) 1580
BsaBI GATNNNNATC 1 cut(s) 786
BsaHI GRCGYC 2 cut(s) 481, 1406
BsaI GGTCTC 1 cut(s) 918
BsaJI CCNNGG 8 cut(s) 387, 490, 928, 984, 1074, 1212, 1317, 1672
BsaWI WCCGGW 1 cut(s) 1099
Bsc4I CCNNNNNNNGG 6 cut(s) 490, 1075, 1080, 1255, 1595, 1663
Bse3DI GCAATG 1 cut(s) 951
Bse8I GATNNNNATC 1 cut(s) 786
BseBI CCWGG 2 cut(s) 1640, 1674
BseDI CCNNGG 8 cut(s) 387, 490, 928, 984, 1074, 1212, 1317, 1672
BseGI GGATG 4 cut(s) 119, 223, 1460, 1672
BseJI GATNNNNATC 1 cut(s) 786
BseLI CCNNNNNNNGG 6 cut(s) 490, 1075, 1080, 1255, 1595, 1663
BseMI GCAATG 1 cut(s) 951
BseXI GCAGC 1 cut(s) 745
BsgI GTGCAG 1 cut(s) 839
Bsh1236I CGCG 1 cut(s) 902
BshFI GGCC 3 cut(s) 849, 1643, 1656
BshNI GGYRCC 3 cut(s) 480, 1105, 1683
BsiHKAI GWGCWC 1 cut(s) 330
BsiSI CCGG 3 cut(s) 389, 490, 1100
BslFI GGGAC 3 cut(s) 95, 580, 1356
BslI CCNNNNNNNGG 6 cut(s) 490, 1075, 1080, 1255, 1595, 1663
BsmAI GTCTC 1 cut(s) 918
BsmFI GGGAC 3 cut(s) 95, 580, 1356
BsmI GAATGC 2 cut(s) 219, 1634
BsnI GGCC 3 cut(s) 849, 1643, 1656
Bso31I GGTCTC 1 cut(s) 918
Bsp119I TTCGAA 1 cut(s) 1359
Bsp1286I GDGCHC 2 cut(s) 330, 827
Bsp143I GATC 3 cut(s) 400, 676, 1489
BspACI CCGC 4 cut(s) 902, 1507, 1607, 1613
BspANI GGCC 3 cut(s) 849, 1643, 1656
BspFNI CGCG 1 cut(s) 902
BspHI TCATGA 2 cut(s) 1203, 1276
BspLI GGNNCC 7 cut(s) 482, 596, 702, 1026, 1107, 1245, 1685
BspOI GCTAGC 1 cut(s) 219
BspPI GGATC 1 cut(s) 395
BspT104I TTCGAA 1 cut(s) 1359
BspT107I GGYRCC 3 cut(s) 480, 1105, 1683
BspTI CTTAAG 1 cut(s) 1376
BspTNI GGTCTC 1 cut(s) 918
BsrDI GCAATG 1 cut(s) 951
BssECI CCNNGG 8 cut(s) 387, 490, 928, 984, 1074, 1212, 1317, 1672
BssMI GATC 3 cut(s) 400, 676, 1489
BssNI GRCGYC 2 cut(s) 481, 1406
BssT1I CCWWGG 4 cut(s) 928, 984, 1212, 1317
Bst2UI CCWGG 2 cut(s) 1640, 1674
Bst4CI ACNGT 1 cut(s) 918
Bst6I CTCTTC 1 cut(s) 1050
BstACI GRCGYC 2 cut(s) 481, 1406
BstAFI CTTAAG 1 cut(s) 1376
BstAPI GCANNNNNTGC 1 cut(s) 1112
BstBAI YACGTR 1 cut(s) 1580
BstBI TTCGAA 1 cut(s) 1359
BstC8I GCNNGC 1 cut(s) 217
BstDEI CTNAG 2 cut(s) 211, 262
BstDSI CCRYGG 1 cut(s) 1074
BstENI CCTNNNNNAGG 1 cut(s) 1253
BstF5I GGATG 4 cut(s) 119, 223, 1460, 1672
BstFNI CGCG 1 cut(s) 902
BstH2I RGCGCY 2 cut(s) 484, 1664
BstHHI GCGC 2 cut(s) 483, 1663
BstKTI GATC 3 cut(s) 403, 679, 1492
BstMAI GTCTC 1 cut(s) 918
BstMBI GATC 3 cut(s) 400, 676, 1489
BstMWI GCNNNNNNNGC 3 cut(s) 892, 1112, 1640
BstNI CCWGG 2 cut(s) 1640, 1674
BstSCI CCNGG 4 cut(s) 387, 489, 1638, 1672
BstUI CGCG 1 cut(s) 902
BstV1I GCAGC 1 cut(s) 745
BsuRI GGCC 3 cut(s) 849, 1643, 1656
BtgI CCRYGG 1 cut(s) 1074
BtsCI GGATG 4 cut(s) 119, 223, 1460, 1672
Cac8I GCNNGC 1 cut(s) 217
CciI TCATGA 2 cut(s) 1203, 1276
CfoI GCGC 2 cut(s) 483, 1663
Cfr13I GGNCC 5 cut(s) 391, 594, 847, 871, 1024
CseI GACGC 1 cut(s) 1414
CviAII CATG 7 cut(s) 74, 550, 586, 994, 1204, 1277, 1529
DdeI CTNAG 2 cut(s) 211, 262
DinI GGCGCC 1 cut(s) 482
DpnI GATC 3 cut(s) 402, 678, 1491
DpnII GATC 3 cut(s) 400, 676, 1489
DraI TTTAAA 1 cut(s) 1477
EaeI YGGCCR 1 cut(s) 1654
Eam1104I CTCTTC 1 cut(s) 1050
EarI CTCTTC 1 cut(s) 1050
Eco130I CCWWGG 4 cut(s) 928, 984, 1212, 1317
Eco147I AGGCCT 1 cut(s) 1643
Eco24I GRGCYC 1 cut(s) 827
Eco31I GGTCTC 1 cut(s) 918
Eco47I GGWCC 4 cut(s) 391, 594, 871, 1024
Eco47III AGCGCT 1 cut(s) 1662
EcoNI CCTNNNNNAGG 1 cut(s) 1253
EcoO109I RGGNCCY 1 cut(s) 594
EcoRII CCWGG 2 cut(s) 1638, 1672
EcoT14I CCWWGG 4 cut(s) 928, 984, 1212, 1317
EcoT38I GRGCYC 1 cut(s) 827
EgeI GGCGCC 1 cut(s) 482
EheI GGCGCC 1 cut(s) 482
ErhI CCWWGG 4 cut(s) 928, 984, 1212, 1317
FaeI CATG 7 cut(s) 77, 553, 589, 997, 1207, 1280, 1532
FaqI GGGAC 3 cut(s) 95, 580, 1356
FatI CATG 7 cut(s) 73, 549, 585, 993, 1203, 1276, 1528
FauI CCCGC 1 cut(s) 1606
FbaI TGATCA 1 cut(s) 676
Fnu4HI GCNGC 1 cut(s) 734
FokI GGATG 4 cut(s) 106, 210, 1447, 1679
FriOI GRGCYC 1 cut(s) 827
Fsp4HI GCNGC 1 cut(s) 734
FspBI CTAG 5 cut(s) 216, 536, 942, 1469, 1629
GlaI GCGC 2 cut(s) 482, 1662
GluI GCNGC 1 cut(s) 734
HaeII RGCGCY 2 cut(s) 484, 1664
HaeIII GGCC 3 cut(s) 849, 1643, 1656
HapII CCGG 3 cut(s) 389, 490, 1100
HgaI GACGC 1 cut(s) 1414
HhaI GCGC 2 cut(s) 483, 1663
Hin1I GRCGYC 2 cut(s) 481, 1406
Hin1II CATG 7 cut(s) 77, 553, 589, 997, 1207, 1280, 1532
Hin6I GCGC 2 cut(s) 481, 1661
HinP1I GCGC 2 cut(s) 481, 1661
HindIII AAGCTT 1 cut(s) 794
HinfI GANTC 3 cut(s) 287, 1200, 1453
HpaII CCGG 3 cut(s) 389, 490, 1100
HphI GGTGA 2 cut(s) 1238, 1496
Hpy166II GTNNAC 1 cut(s) 1577
Hpy188I TCNGA 4 cut(s) 667, 963, 1390, 1625
Hpy188III TCNNGA 7 cut(s) 394, 857, 923, 1204, 1277, 1469, 1690
Hpy8I GTNNAC 1 cut(s) 1577
HpyAV CCTTC 8 cut(s) 635, 716, 958, 1217, 1259, 1274, 1355, 1571
HpyCH4III ACNGT 1 cut(s) 918
HpyCH4IV ACGT 3 cut(s) 134, 642, 1579
HpyF10VI GCNNNNNNNGC 3 cut(s) 892, 1112, 1640
HpyF3I CTNAG 2 cut(s) 211, 262
HpySE526I ACGT 3 cut(s) 134, 642, 1579
Hsp92I GRCGYC 2 cut(s) 481, 1406
Hsp92II CATG 7 cut(s) 77, 553, 589, 997, 1207, 1280, 1532
HspAI GCGC 2 cut(s) 481, 1661
KasI GGCGCC 1 cut(s) 480
Ksp22I TGATCA 1 cut(s) 676
Kzo9I GATC 3 cut(s) 400, 676, 1489
LmnI GCTCC 2 cut(s) 1120, 1625
Lsp1109I GCAGC 1 cut(s) 745
LweI GCATC 4 cut(s) 477, 1293, 1469, 1629
MaeI CTAG 5 cut(s) 216, 536, 942, 1469, 1629
MaeII ACGT 3 cut(s) 134, 642, 1579
MaeIII GTNAC 3 cut(s) 296, 576, 1004
MalI GATC 3 cut(s) 402, 678, 1491
MboI GATC 3 cut(s) 400, 676, 1489
MboII GAAGA 5 cut(s) 153, 553, 1067, 1229, 1232
MfeI CAATTG 1 cut(s) 160
MhlI GDGCHC 2 cut(s) 330, 827
MlsI TGGCCA 1 cut(s) 1656
MluNI TGGCCA 1 cut(s) 1656
Mly113I GGCGCC 1 cut(s) 481
MmeI TCCRAC 5 cut(s) 849, 997, 1199, 1306, 1368
Mox20I TGGCCA 1 cut(s) 1656
MroXI GAANNNNTTC 1 cut(s) 1248
MscI TGGCCA 1 cut(s) 1656
MseI TTAA 8 cut(s) 371, 444, 798, 806, 1164, 1377, 1448, 1476
MslI CAYNNNNRTG 1 cut(s) 323
Msp20I TGGCCA 1 cut(s) 1656
MspCI CTTAAG 1 cut(s) 1376
MspI CCGG 3 cut(s) 389, 490, 1100
MspR9I CCNGG 4 cut(s) 389, 491, 1640, 1674
MunI CAATTG 1 cut(s) 160
Mva1269I GAATGC 2 cut(s) 219, 1634
MvaI CCWGG 2 cut(s) 1640, 1674
MvnI CGCG 1 cut(s) 902
MwoI GCNNNNNNNGC 3 cut(s) 892, 1112, 1640
NarI GGCGCC 1 cut(s) 481
NciI CCSGG 2 cut(s) 389, 491
NdeII GATC 3 cut(s) 400, 676, 1489
NheI GCTAGC 1 cut(s) 215
NlaIII CATG 7 cut(s) 77, 553, 589, 997, 1207, 1280, 1532
NlaIV GGNNCC 7 cut(s) 482, 596, 702, 1026, 1107, 1245, 1685
NmuCI GTSAC 2 cut(s) 576, 1004
NspV TTCGAA 1 cut(s) 1359
OliI CACNNNNGTG 1 cut(s) 323
PagI TCATGA 2 cut(s) 1203, 1276
PceI AGGCCT 1 cut(s) 1643
PcsI WCGNNNNNNNCGW 1 cut(s) 906
PctI GAATGC 2 cut(s) 219, 1634
PdmI GAANNNNTTC 1 cut(s) 1248
PfeI GAWTC 3 cut(s) 287, 1200, 1453
PflMI CCANNNNNTGG 1 cut(s) 1663
PkrI GCNGC 1 cut(s) 735
PluTI GGCGCC 1 cut(s) 484
Ppu21I YACGTR 1 cut(s) 1580
PpuMI RGGWCCY 1 cut(s) 594
PshBI ATTAAT 1 cut(s) 806
PsiI TTATAA 3 cut(s) 36, 276, 786
Psp1406I AACGTT 1 cut(s) 134
Psp5II RGGWCCY 1 cut(s) 594
Psp6I CCWGG 2 cut(s) 1638, 1672
PspGI CCWGG 2 cut(s) 1638, 1672
PspN4I GGNNCC 7 cut(s) 482, 596, 702, 1026, 1107, 1245, 1685
PspPI GGNCC 5 cut(s) 391, 594, 847, 871, 1024
PspPPI RGGWCCY 1 cut(s) 594
PsrI GAACNNNNNNTAC 2 cut(s) 389, 421
RseI CAYNNNNRTG 1 cut(s) 323
SaqAI TTAA 8 cut(s) 371, 444, 798, 806, 1164, 1377, 1448, 1476
SatI GCNGC 1 cut(s) 734
Sau3AI GATC 3 cut(s) 400, 676, 1489
Sau96I GGNCC 5 cut(s) 391, 594, 847, 871, 1024
ScrFI CCNGG 4 cut(s) 389, 491, 1640, 1674
SduI GDGCHC 2 cut(s) 330, 827
SfaNI GCATC 4 cut(s) 477, 1293, 1469, 1629
SfoI GGCGCC 1 cut(s) 482
SfuI TTCGAA 1 cut(s) 1359
SinI GGWCC 4 cut(s) 391, 594, 871, 1024
SmiMI CAYNNNNRTG 1 cut(s) 323
SmlI CTYRAG 2 cut(s) 766, 1376
SmoI CTYRAG 2 cut(s) 766, 1376
SseBI AGGCCT 1 cut(s) 1643
SsiI CCGC 4 cut(s) 902, 1507, 1607, 1613
SspDI GGCGCC 1 cut(s) 480
SspMI CTAG 5 cut(s) 216, 536, 942, 1469, 1629
StuI AGGCCT 1 cut(s) 1643
StyD4I CCNGG 4 cut(s) 387, 489, 1638, 1672
StyI CCWWGG 4 cut(s) 928, 984, 1212, 1317
TaaI ACNGT 1 cut(s) 918
TaiI ACGT 3 cut(s) 137, 645, 1582
TaqI TCGA 2 cut(s) 922, 1359
TfiI GAWTC 3 cut(s) 287, 1200, 1453
Tru1I TTAA 8 cut(s) 371, 444, 798, 806, 1164, 1377, 1448, 1476
Tru9I TTAA 8 cut(s) 371, 444, 798, 806, 1164, 1377, 1448, 1476
TseFI GTSAC 2 cut(s) 576, 1004
TseI GCWGC 1 cut(s) 733
Tsp45I GTSAC 2 cut(s) 576, 1004
TspGWI ACGGA 1 cut(s) 1037
Van91I CCANNNNNTGG 1 cut(s) 1663
Vha464I CTTAAG 1 cut(s) 1376
VpaK11BI GGWCC 4 cut(s) 391, 594, 871, 1024
VspI ATTAAT 1 cut(s) 806
XagI CCTNNNNNAGG 1 cut(s) 1253
XapI RAATTY 8 cut(s) 314, 473, 502, 971, 1150, 1271, 1416, 1472
XbaI TCTAGA 1 cut(s) 1468
XcmI CCANNNNNNNNNTGG 1 cut(s) 1081
XmnI GAANNNNTTC 1 cut(s) 1248
XspI CTAG 5 cut(s) 216, 536, 942, 1469, 1629
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.