pycom12503g00010

Chloroplast-localized elongation factor EF-G involved in protein synthesis in plastids. Catalyzes the GTP-dependent ribosomal translocation step during translation elongation. During this step, the ribosome changes from the pre-translocational (PRE) to the post-translocational (POST) state as the newly formed A- site-bound peptidyl-tRNA and P-site-bound deacylated tRNA move to the P and E sites, respectively. Catalyzes the coordinated movement of the two tRNA molecules, the mRNA and conformational changes in the ribosome

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00012503
Physical Location & Seq
Forward (+)
64125 .. 65444
1320 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 1320 bp
ATGCAGAGTGTCCCTACATTTGGTGCTTCATATAGGCAAGGATTTCAAGCCAATCAATGTCCACAAAGAGAGTGGAGGGATCATTCAAACTCTATGTGGTGGGAAGCTCAACAAGTTCAACGTGAAGCATATTGGCAGCCATATGAGGAGTTCTATTCAAGACCTATGCAGCCACCACAACTTCATATGCAATATGCTCAATTAAATTCAAGTTCGTCAATAGATTATAATCAAATTCTTAATGAATTAAATTCTTTGGTGCAGGGGTCACAAAATCAAGTCAAGGAGGCTCAACAAGAAGCATATTGGCAACCATATGAGGAGTTTTATACAACACCTATGCAGCAACCACAACCTCCCCCACAACAATTCCAATCAAGTTCAAGTATGTCCATGGATAATGATAAAAATTTTCAATTACTAACCTCTTTGACGCAGGACGAACAAAATCAAGACAAGAAGTTGGGTAAATTGGAGGAGCAAATTGGGCAGATTATGGAGTTCATGAAACAAATTCAAGAGCAAAGTGAACTCTCCAACTCAACTATTGAAAACTCGAAGGAAGATTTTGAAATCCATAATGCTATCACTTTGGGAAGTGCTATGGAGGTTGGAGCTGACCTAAAAATGTCCAAATATAGCCTAGAAGTGGATGAGGAGCTGCTAATTGAGGAGGAGGAAGAAGACATGCACACGGCAAGGGTAGAACAACCCTTGCCGCAGCCCCCTAAGCCCTCTAAACCACCCACCACAAGTAAGGACGTCCCAATTCCATGTTATTCTGATGTTATTCTACCCAATGTCCCTTTTCCTAGCAGGTTTTTGATTCCCAACCAAGAAGAGAGTAAAAAGGACATCGTGGAAGCCTTCCCAAAGGTGCAGAATGCTATTCCAATTCTTGGTGCAACACAGCAAGTTTTAGATGGTGTTGAATTCTTCAAAGGACTTTGTACACCAAGAAGAATGATTCAAGAGAAGGTAGTGGCTGGAGAAGATGTAGAAGGCATCAAAGAGGACATATTTGAAACCACAAAACCCAAAGAAGTTGAATTTGATGACATTGGACAAGTCATAACCATCACATGCAATCTGGCCAAGTCCAATATCCCTGAAACTTTCAAAGGAGTGGTGTTTGTCATTGAGTTCTTGTCGGACAAAACAAGTAAGTCATCTTCTTCAAATTCCATTACATTTTATACTAACTTGCTGATTTTGATGAATCAGGCACCTACACTAGAATTCAAACCAATGCCGGTTCACTTCAAGTATCACCTTCCATTCAAGGATCAATTCCATGCCGTGGGACCTAGGGAAGTTTGA

Protein Analysis

440

Amino Acids

50.43

Weight (kDa)

4.67

Isoelectric Point (pI)

53.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 228
AatII GACGTC 1 cut(s) 765
Acc36I ACCTGC 1 cut(s) 807
AccB1I GGYRCC 1 cut(s) 1225
AccB7I CCANNNNNTGG 2 cut(s) 899, 1300
AciI CCGC 1 cut(s) 719
AclWI GGATC 2 cut(s) 87, 1293
AcoI YGGCCR 1 cut(s) 1092
AcsI RAATTY 9 cut(s) 205, 234, 250, 409, 513, 932, 1049, 1180, 1238
AcyI GRCGYC 1 cut(s) 762
AfaI GTAC 1 cut(s) 952
AfiI CCNNNNNNNGG 4 cut(s) 20, 649, 899, 1300
AluBI AGCT 3 cut(s) 107, 617, 661
AluI AGCT 3 cut(s) 107, 617, 661
AlwI GGATC 2 cut(s) 87, 1293
AoxI GGCC 1 cut(s) 1092
ApeKI GCWGC 5 cut(s) 136, 169, 343, 661, 721
ApoI RAATTY 9 cut(s) 205, 234, 250, 409, 513, 932, 1049, 1180, 1238
AspA2I CCTAGG 1 cut(s) 1307
AspS9I GGNCC 1 cut(s) 1304
AsuHPI GGTGA 1 cut(s) 1262
AvaII GGWCC 1 cut(s) 1304
AvrII CCTAGG 1 cut(s) 1307
BalI TGGCCA 1 cut(s) 1094
BanI GGYRCC 1 cut(s) 1225
BarI GAAGNNNNNNTAC 2 cut(s) 1156, 1188
BbsI GAAGAC 1 cut(s) 690
BbvI GCAGC 5 cut(s) 148, 181, 355, 648, 733
BccI CCATC 2 cut(s) 917, 1085
BceAI ACGGC 2 cut(s) 711, 1283
BfaI CTAG 4 cut(s) 644, 813, 1235, 1308
BfuAI ACCTGC 1 cut(s) 807
BisI GCNGC 6 cut(s) 137, 170, 344, 662, 719, 722
BlnI CCTAGG 1 cut(s) 1307
BlsI GCNGC 6 cut(s) 138, 171, 345, 663, 720, 723
Bme18I GGWCC 1 cut(s) 1304
BmgT120I GGNCC 1 cut(s) 1304
BmiI GGNNCC 2 cut(s) 1227, 1305
BmsI GCATC 1 cut(s) 1014
BpiI GAAGAC 1 cut(s) 690
BpmI CTGGAG 1 cut(s) 1008
Bpu10I CCTNAGC 1 cut(s) 729
BsaBI GATNNNNATC 1 cut(s) 228
BsaHI GRCGYC 1 cut(s) 762
BsaJI CCNNGG 3 cut(s) 393, 1299, 1307
BsaXI ACNNNNNCTCC 2 cut(s) 981, 1011
Bsc4I CCNNNNNNNGG 4 cut(s) 20, 649, 899, 1300
Bse118I RCCGGY 1 cut(s) 1252
Bse8I GATNNNNATC 1 cut(s) 228
BseDI CCNNGG 3 cut(s) 393, 1299, 1307
BseGI GGATG 1 cut(s) 658
BseJI GATNNNNATC 1 cut(s) 228
BseLI CCNNNNNNNGG 4 cut(s) 20, 649, 899, 1300
BseRI GAGGAG 6 cut(s) 161, 335, 491, 671, 686, 689
BseXI GCAGC 5 cut(s) 148, 181, 355, 648, 733
BsgI GTGCAG 2 cut(s) 281, 899
BshFI GGCC 1 cut(s) 1094
BshNI GGYRCC 1 cut(s) 1225
BsiSI CCGG 1 cut(s) 1253
BslFI GGGAC 2 cut(s) 749, 788
BslI CCNNNNNNNGG 4 cut(s) 20, 649, 899, 1300
BsmFI GGGAC 2 cut(s) 749, 788
BsmI GAATGC 1 cut(s) 889
BsnI GGCC 1 cut(s) 1094
Bsp1407I TGTACA 1 cut(s) 950
Bsp143I GATC 2 cut(s) 79, 1285
Bsp19I CCATGG 1 cut(s) 393
BspACI CCGC 1 cut(s) 719
BspANI GGCC 1 cut(s) 1094
BspHI TCATGA 1 cut(s) 504
BspLI GGNNCC 2 cut(s) 1227, 1305
BspMI ACCTGC 1 cut(s) 807
BspPI GGATC 2 cut(s) 87, 1293
BspT107I GGYRCC 1 cut(s) 1225
BsrFI RCCGGY 1 cut(s) 1252
BsrGI TGTACA 1 cut(s) 950
BssAI RCCGGY 1 cut(s) 1252
BssECI CCNNGG 3 cut(s) 393, 1299, 1307
BssMI GATC 2 cut(s) 79, 1285
BssNI GRCGYC 1 cut(s) 762
BssT1I CCWWGG 2 cut(s) 393, 1307
Bst6I CTCTTC 1 cut(s) 834
BstACI GRCGYC 1 cut(s) 762
BstAUI TGTACA 1 cut(s) 950
BstDEI CTNAG 1 cut(s) 729
BstDSI CCRYGG 2 cut(s) 393, 1299
BstF5I GGATG 1 cut(s) 658
BstKTI GATC 2 cut(s) 82, 1288
BstMBI GATC 2 cut(s) 79, 1285
BstMWI GCNNNNNNNGC 2 cut(s) 487, 730
BstNSI RCATGY 2 cut(s) 691, 1086
BstV1I GCAGC 5 cut(s) 148, 181, 355, 648, 733
BstV2I GAAGAC 1 cut(s) 690
BsuRI GGCC 1 cut(s) 1094
BtgI CCRYGG 2 cut(s) 393, 1299
BtsCI GGATG 1 cut(s) 658
BveI ACCTGC 1 cut(s) 807
CciI TCATGA 1 cut(s) 504
Cfr10I RCCGGY 1 cut(s) 1252
Cfr13I GGNCC 1 cut(s) 1304
CseI GACGC 1 cut(s) 442
Csp6I GTAC 1 cut(s) 951
CspCI CAANNNNNGTGG 2 cut(s) 53, 88
CviAII CATG 6 cut(s) 394, 505, 688, 774, 1083, 1295
CviQI GTAC 1 cut(s) 951
DdeI CTNAG 1 cut(s) 729
DpnI GATC 2 cut(s) 81, 1287
DpnII GATC 2 cut(s) 79, 1285
EaeI YGGCCR 1 cut(s) 1092
Eam1104I CTCTTC 1 cut(s) 834
EarI CTCTTC 1 cut(s) 834
Eco130I CCWWGG 2 cut(s) 393, 1307
Eco47I GGWCC 1 cut(s) 1304
EcoO109I RGGNCCY 1 cut(s) 1304
EcoRI GAATTC 2 cut(s) 932, 1238
EcoT14I CCWWGG 2 cut(s) 393, 1307
ErhI CCWWGG 2 cut(s) 393, 1307
FaeI CATG 6 cut(s) 397, 508, 691, 777, 1086, 1298
FaqI GGGAC 2 cut(s) 749, 788
FatI CATG 6 cut(s) 393, 504, 687, 773, 1082, 1294
FauNDI CATATG 3 cut(s) 142, 186, 316
Fnu4HI GCNGC 6 cut(s) 137, 170, 344, 662, 719, 722
FokI GGATG 1 cut(s) 665
Fsp4HI GCNGC 6 cut(s) 137, 170, 344, 662, 719, 722
FspBI CTAG 4 cut(s) 644, 813, 1235, 1308
GluI GCNGC 6 cut(s) 137, 170, 344, 662, 719, 722
GsuI CTGGAG 1 cut(s) 1008
HaeIII GGCC 1 cut(s) 1094
HapII CCGG 1 cut(s) 1253
HgaI GACGC 1 cut(s) 442
Hin1I GRCGYC 1 cut(s) 762
Hin1II CATG 6 cut(s) 397, 508, 691, 777, 1086, 1298
HinfI GANTC 3 cut(s) 826, 967, 1219
HpaII CCGG 1 cut(s) 1253
HphI GGTGA 1 cut(s) 1262
Hpy166II GTNNAC 4 cut(s) 62, 530, 953, 1258
Hpy188I TCNGA 2 cut(s) 784, 1153
Hpy188III TCNNGA 5 cut(s) 159, 452, 505, 518, 971
Hpy8I GTNNAC 4 cut(s) 62, 530, 953, 1258
HpyAV CCTTC 5 cut(s) 553, 877, 970, 995, 1283
HpyCH4IV ACGT 2 cut(s) 121, 762
HpyCH4V TGCA 9 cut(s) 4, 169, 190, 262, 343, 691, 880, 905, 1086
HpyF10VI GCNNNNNNNGC 2 cut(s) 487, 730
HpyF3I CTNAG 1 cut(s) 729
HpySE526I ACGT 2 cut(s) 121, 762
Hsp92I GRCGYC 1 cut(s) 762
Hsp92II CATG 6 cut(s) 397, 508, 691, 777, 1086, 1298
Kzo9I GATC 2 cut(s) 79, 1285
LmnI GCTCC 3 cut(s) 478, 614, 658
LpnPI CCDG 8 cut(s) 248, 422, 802, 972, 1076, 1122, 1208, 1266
Lsp1109I GCAGC 5 cut(s) 148, 181, 355, 648, 733
LweI GCATC 1 cut(s) 1014
MaeI CTAG 4 cut(s) 644, 813, 1235, 1308
MaeII ACGT 2 cut(s) 121, 762
MaeIII GTNAC 1 cut(s) 267
MalI GATC 2 cut(s) 81, 1287
MboI GATC 2 cut(s) 79, 1285
MboII GAAGA 9 cut(s) 575, 692, 695, 851, 928, 972, 1004, 1164, 1167
MlsI TGGCCA 1 cut(s) 1094
MluNI TGGCCA 1 cut(s) 1094
MmeI TCCRAC 3 cut(s) 561, 592, 1131
Mox20I TGGCCA 1 cut(s) 1094
MscI TGGCCA 1 cut(s) 1094
MseI TTAA 3 cut(s) 203, 240, 248
Msp20I TGGCCA 1 cut(s) 1094
MspI CCGG 1 cut(s) 1253
Mva1269I GAATGC 1 cut(s) 889
MwoI GCNNNNNNNGC 2 cut(s) 487, 730
NcoI CCATGG 1 cut(s) 393
NdeI CATATG 3 cut(s) 142, 186, 316
NdeII GATC 2 cut(s) 79, 1285
NlaIII CATG 6 cut(s) 397, 508, 691, 777, 1086, 1298
NlaIV GGNNCC 2 cut(s) 1227, 1305
NmuCI GTSAC 1 cut(s) 267
NspI RCATGY 2 cut(s) 691, 1086
PagI TCATGA 1 cut(s) 504
PctI GAATGC 1 cut(s) 889
PfeI GAWTC 3 cut(s) 826, 967, 1219
PflMI CCANNNNNTGG 2 cut(s) 899, 1300
PkrI GCNGC 6 cut(s) 138, 171, 345, 663, 720, 723
PpuMI RGGWCCY 1 cut(s) 1304
PsiI TTATAA 1 cut(s) 228
Psp5II RGGWCCY 1 cut(s) 1304
PspN4I GGNNCC 2 cut(s) 1227, 1305
PspPI GGNCC 1 cut(s) 1304
PspPPI RGGWCCY 1 cut(s) 1304
RsaI GTAC 1 cut(s) 952
RsaNI GTAC 1 cut(s) 951
SaqAI TTAA 3 cut(s) 203, 240, 248
SatI GCNGC 6 cut(s) 137, 170, 344, 662, 719, 722
Sau3AI GATC 2 cut(s) 79, 1285
Sau96I GGNCC 1 cut(s) 1304
SfaNI GCATC 1 cut(s) 1014
SinI GGWCC 1 cut(s) 1304
SsiI CCGC 1 cut(s) 719
SspMI CTAG 4 cut(s) 644, 813, 1235, 1308
StyI CCWWGG 2 cut(s) 393, 1307
TaiI ACGT 2 cut(s) 124, 765
TaqI TCGA 1 cut(s) 557
TatI WGTACW 1 cut(s) 950
TauI GCSGC 1 cut(s) 721
TfiI GAWTC 3 cut(s) 826, 967, 1219
Tru1I TTAA 3 cut(s) 203, 240, 248
Tru9I TTAA 3 cut(s) 203, 240, 248
TseFI GTSAC 1 cut(s) 267
TseI GCWGC 5 cut(s) 136, 169, 343, 661, 721
Tsp45I GTSAC 1 cut(s) 267
TspDTI ATGAA 6 cut(s) 18, 173, 258, 493, 521, 1232
Van91I CCANNNNNTGG 2 cut(s) 899, 1300
VpaK11BI GGWCC 1 cut(s) 1304
XapI RAATTY 9 cut(s) 205, 234, 250, 409, 513, 932, 1049, 1180, 1238
XceI RCATGY 2 cut(s) 691, 1086
XcmI CCANNNNNNNNNTGG 1 cut(s) 69
XmaJI CCTAGG 1 cut(s) 1307
XspI CTAG 4 cut(s) 644, 813, 1235, 1308
ZraI GACGTC 1 cut(s) 763
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.