pycom1256g00220

Maspardin-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00001256
Physical Location & Seq
Forward (+)
176838 .. 178867
2030 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 1479 bp
ATGCAATTGGAAATCATTTTATTATGCAAGTCCATTCATTTCCGTCAATTTCATATTTACAATTTGTTTTCTTTACAATCTATCCATTTTAGTTTAAATTCGTCCAAAATCAATCCCCCCATATTTCGTTTAAGTCTTATAAATAGTGTTTTATATTCCCTCCTAATCCCCGGTCCAGAACGATCCCTACTTACATCATTACTACAATTGTCAAAAAGAGGGTTTAATTTGACCCTTGGTTCTTTTCTTTTTTTTGGTTTAGTTGTTTTCGTTTTAGTTTCTAACTTAGTGTTGTTTCTTTGTTTGTTGTTACTTTTGATATTTGATTTATTTGCTAGCATTCAAGCTCAATTGGCAAATCTTACTTCTCAATTGTCGCCGTATGCCGAAAGGACCACAATGCAGAGTGTCCCTACATTTGGTGCTTCATATAGGCAAGGATTTCAAGCCAATCAATGTCCACAAAGAGATTGGAGGGATCATTCAAACTCTATATGGTGGGAAGATCAACAAGTTCAACGTGAAGCATATTGGCAACCATATGAGGAGTTCTATTCAAGACCTATGCAGCCACCACAACTTCATATGCAATATGCTCAATTAAATTCAAGTTCGCCAGTAGATTATATTCAAATTCTTAATGAAATAAATTCTTTGGCGCAGGGGTCACAAAATCAAGCCAAGGAGGCTCAACAAGAAGCATATTGGCAACCATATGAGGAGTTCAATACAACACCTATGCAGCCACCACAACCTCACCCACAACAATTCCAATCAAGTTCAAGTATGTCCATGGTACATAAACAAGTCTTAATTCAAATAGATAAAGCCATGGTTTCGAAATTCCCCCTAGCCAAAAAGGGGATTATCCAGGATGAATTTGATGCACGGCTAGGCTTCCCTTCCTCTTCCTTGCTGCGGTACAAGTTGTGGATGGTGGATTTGGGGGTTTTGAATGGTGGTGCGGTAGGTGGTGTATGGAGGTGTATGGCGTGGATGGAGGATGAAGAATGGAGGCTAGAGTGTTGCGGCAATGATAGGAGCATATTCATGCAACTTAAATGGCTTGTTCTCCTATTTTCGTGTGTTTGTAGGCCAAAAGGGCTAAAGGAGCAAAAAGATCTTATGCTTGGAGCCAAAGTGTTGGACGAAATTAAAAACCTAATTGAAGACCAAAGTGTTGGAACCTTGTTCCTTTTAAACATTCCAACATTCCACTCCTTCATTCACCACTTATCATATCATACACTTATCTTATCATCACCACATATCATATATTTATTACTTATCATATCATTCATTCATCTACATATCAATAACCACTTATCTTATCACTCAACATATCATACACTTATCACTTATCACTTCCATTCACTTATCACTTATCACTTCCATTCACTTATCACTCACCACATATCATTCATTTATCACCACATATCATTCATTTATCACTTAACATATCATTCATTTATCACTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

493

Amino Acids

57.26

Weight (kDa)

6.97

Isoelectric Point (pI)

50.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 140
AciI CCGC 3 cut(s) 919, 965, 1029
AclWI GGATC 2 cut(s) 177, 486
AcsI RAATTY 6 cut(s) 97, 604, 633, 649, 842, 878
AfaI GTAC 2 cut(s) 798, 923
AfiI CCNNNNNNNGG 3 cut(s) 419, 861, 918
AjnI CCWGG 1 cut(s) 870
AluBI AGCT 1 cut(s) 347
AluI AGCT 1 cut(s) 347
AlwI GGATC 2 cut(s) 177, 486
AoxI GGCC 1 cut(s) 1094
ApeKI GCWGC 3 cut(s) 568, 742, 916
ApoI RAATTY 6 cut(s) 97, 604, 633, 649, 842, 878
AspLEI GCGC 1 cut(s) 661
AspS9I GGNCC 2 cut(s) 173, 393
AsuC2I CCSGG 1 cut(s) 171
AsuHPI GGTGA 5 cut(s) 749, 1220, 1254, 1400, 1421
AsuII TTCGAA 1 cut(s) 839
AsuNHI GCTAGC 1 cut(s) 335
AvaII GGWCC 2 cut(s) 173, 393
BbsI GAAGAC 1 cut(s) 1176
BbvI GCAGC 3 cut(s) 580, 754, 903
BccI CCATC 2 cut(s) 928, 991
BceAI ACGGC 2 cut(s) 364, 905
BciT130I CCWGG 1 cut(s) 872
BcnI CCSGG 1 cut(s) 171
BfaI CTAG 4 cut(s) 336, 851, 893, 1019
BglI GCCNNNNNGGC 2 cut(s) 686, 1102
BglII AGATCT 1 cut(s) 1120
BisI GCNGC 4 cut(s) 569, 743, 917, 1030
BlsI GCNGC 4 cut(s) 570, 744, 918, 1031
Bme1390I CCNGG 2 cut(s) 171, 872
Bme18I GGWCC 2 cut(s) 173, 393
BmgT120I GGNCC 2 cut(s) 173, 393
BmiI GGNNCC 2 cut(s) 1135, 1186
BmrFI CCNGG 2 cut(s) 171, 872
BmsI GCATC 1 cut(s) 874
BmtI GCTAGC 1 cut(s) 339
BpiI GAAGAC 1 cut(s) 1176
Bpu14I TTCGAA 1 cut(s) 839
BpuMI CCSGG 1 cut(s) 171
BsaJI CCNNGG 5 cut(s) 169, 235, 681, 792, 831
BsaXI ACNNNNNCTCC 2 cut(s) 1125, 1155
Bsc4I CCNNNNNNNGG 3 cut(s) 419, 861, 918
Bse1I ACTGG 1 cut(s) 617
Bse3DI GCAATG 1 cut(s) 1039
BseBI CCWGG 1 cut(s) 872
BseDI CCNNGG 5 cut(s) 169, 235, 681, 792, 831
BseGI GGATG 4 cut(s) 880, 939, 1002, 1009
BseLI CCNNNNNNNGG 3 cut(s) 419, 861, 918
BseMI GCAATG 1 cut(s) 1039
BseNI ACTGG 1 cut(s) 617
BseRI GAGGAG 2 cut(s) 560, 734
BseXI GCAGC 3 cut(s) 580, 754, 903
BshFI GGCC 1 cut(s) 1096
BsiSI CCGG 1 cut(s) 171
BslFI GGGAC 1 cut(s) 395
BslI CCNNNNNNNGG 3 cut(s) 419, 861, 918
BsmFI GGGAC 1 cut(s) 395
BsmI GAATGC 1 cut(s) 339
BsnI GGCC 1 cut(s) 1096
Bsp119I TTCGAA 1 cut(s) 839
Bsp143I GATC 4 cut(s) 182, 478, 505, 1120
Bsp19I CCATGG 2 cut(s) 792, 831
BspACI CCGC 3 cut(s) 919, 965, 1029
BspANI GGCC 1 cut(s) 1096
BspLI GGNNCC 2 cut(s) 1135, 1186
BspOI GCTAGC 1 cut(s) 339
BspPI GGATC 2 cut(s) 177, 486
BspT104I TTCGAA 1 cut(s) 839
BsrDI GCAATG 1 cut(s) 1039
BsrI ACTGG 1 cut(s) 617
BssECI CCNNGG 5 cut(s) 169, 235, 681, 792, 831
BssMI GATC 4 cut(s) 182, 478, 505, 1120
BssT1I CCWWGG 4 cut(s) 235, 681, 792, 831
Bst2UI CCWGG 1 cut(s) 872
Bst6I CTCTTC 1 cut(s) 913
BstBI TTCGAA 1 cut(s) 839
BstC8I GCNNGC 1 cut(s) 337
BstDEI CTNAG 1 cut(s) 286
BstDSI CCRYGG 2 cut(s) 792, 831
BstF5I GGATG 4 cut(s) 880, 939, 1002, 1009
BstHHI GCGC 1 cut(s) 661
BstKTI GATC 4 cut(s) 185, 481, 508, 1123
BstMBI GATC 4 cut(s) 182, 478, 505, 1120
BstMWI GCNNNNNNNGC 4 cut(s) 353, 686, 1102, 1111
BstNI CCWGG 1 cut(s) 872
BstSCI CCNGG 2 cut(s) 169, 870
BstV1I GCAGC 3 cut(s) 580, 754, 903
BstV2I GAAGAC 1 cut(s) 1176
BstX2I RGATCY 1 cut(s) 1120
BstXI CCANNNNNNTGG 2 cut(s) 1144, 1181
BstYI RGATCY 1 cut(s) 1120
BsuRI GGCC 1 cut(s) 1096
BtgI CCRYGG 2 cut(s) 792, 831
BtsCI GGATG 4 cut(s) 880, 939, 1002, 1009
Cac8I GCNNGC 1 cut(s) 337
CfoI GCGC 1 cut(s) 661
Cfr13I GGNCC 2 cut(s) 173, 393
Csp6I GTAC 2 cut(s) 797, 922
CviAII CATG 3 cut(s) 793, 832, 1051
CviQI GTAC 2 cut(s) 797, 922
DdeI CTNAG 1 cut(s) 286
DpnI GATC 4 cut(s) 184, 480, 507, 1122
DpnII GATC 4 cut(s) 182, 478, 505, 1120
DraI TTTAAA 2 cut(s) 96, 1200
Eam1104I CTCTTC 1 cut(s) 913
EarI CTCTTC 1 cut(s) 913
Eco130I CCWWGG 4 cut(s) 235, 681, 792, 831
Eco47I GGWCC 2 cut(s) 173, 393
EcoRII CCWGG 1 cut(s) 870
EcoT14I CCWWGG 4 cut(s) 235, 681, 792, 831
ErhI CCWWGG 4 cut(s) 235, 681, 792, 831
FaeI CATG 3 cut(s) 796, 835, 1054
FaqI GGGAC 1 cut(s) 395
FatI CATG 3 cut(s) 792, 831, 1050
FauNDI CATATG 3 cut(s) 541, 585, 715
Fnu4HI GCNGC 4 cut(s) 569, 743, 917, 1030
FokI GGATG 4 cut(s) 887, 946, 1009, 1016
Fsp4HI GCNGC 4 cut(s) 569, 743, 917, 1030
FspBI CTAG 4 cut(s) 336, 851, 893, 1019
GlaI GCGC 1 cut(s) 660
GluI GCNGC 4 cut(s) 569, 743, 917, 1030
HaeIII GGCC 1 cut(s) 1096
HapII CCGG 1 cut(s) 171
HhaI GCGC 1 cut(s) 661
Hin1II CATG 3 cut(s) 796, 835, 1054
Hin6I GCGC 1 cut(s) 659
HinP1I GCGC 1 cut(s) 659
HpaII CCGG 1 cut(s) 171
HphI GGTGA 5 cut(s) 749, 1220, 1254, 1400, 1421
Hpy166II GTNNAC 1 cut(s) 461
Hpy188III TCNNGA 2 cut(s) 176, 558
Hpy8I GTNNAC 1 cut(s) 461
HpyAV CCTTC 2 cut(s) 912, 1231
HpyCH4IV ACGT 1 cut(s) 520
HpyCH4V TGCA 8 cut(s) 4, 27, 403, 568, 589, 742, 887, 1054
HpyF10VI GCNNNNNNNGC 4 cut(s) 353, 686, 1102, 1111
HpyF3I CTNAG 1 cut(s) 286
HpySE526I ACGT 1 cut(s) 520
Hsp92II CATG 3 cut(s) 796, 835, 1054
HspAI GCGC 1 cut(s) 659
Kzo9I GATC 4 cut(s) 182, 478, 505, 1120
LmnI GCTCC 3 cut(s) 1041, 1111, 1133
LpnPI CCDG 6 cut(s) 184, 189, 630, 647, 857, 884
Lsp1109I GCAGC 3 cut(s) 580, 754, 903
LweI GCATC 1 cut(s) 874
MaeI CTAG 4 cut(s) 336, 851, 893, 1019
MaeII ACGT 1 cut(s) 520
MaeIII GTNAC 2 cut(s) 309, 666
MalI GATC 4 cut(s) 184, 480, 507, 1122
MboI GATC 4 cut(s) 182, 478, 505, 1120
MboII GAAGA 4 cut(s) 515, 900, 1019, 1181
MfeI CAATTG 4 cut(s) 5, 206, 350, 371
MflI RGATCY 1 cut(s) 1120
MmeI TCCRAC 3 cut(s) 1125, 1162, 1232
MslI CAYNNNNRTG 1 cut(s) 1049
MspI CCGG 1 cut(s) 171
MspR9I CCNGG 2 cut(s) 171, 872
MunI CAATTG 4 cut(s) 5, 206, 350, 371
Mva1269I GAATGC 1 cut(s) 339
MvaI CCWGG 1 cut(s) 872
MwoI GCNNNNNNNGC 4 cut(s) 353, 686, 1102, 1111
NciI CCSGG 1 cut(s) 171
NcoI CCATGG 2 cut(s) 792, 831
NdeI CATATG 3 cut(s) 541, 585, 715
NdeII GATC 4 cut(s) 182, 478, 505, 1120
NheI GCTAGC 1 cut(s) 335
NlaIII CATG 3 cut(s) 796, 835, 1054
NlaIV GGNNCC 2 cut(s) 1135, 1186
NmuCI GTSAC 1 cut(s) 666
NspV TTCGAA 1 cut(s) 839
PctI GAATGC 1 cut(s) 339
PfoI TCCNGGA 1 cut(s) 870
PkrI GCNGC 4 cut(s) 570, 744, 918, 1031
PsiI TTATAA 1 cut(s) 140
Psp6I CCWGG 1 cut(s) 870
PspGI CCWGG 1 cut(s) 870
PspN4I GGNNCC 2 cut(s) 1135, 1186
PspPI GGNCC 2 cut(s) 173, 393
PsrI GAACNNNNNNTAC 2 cut(s) 171, 203
PsuI RGATCY 1 cut(s) 1120
RsaI GTAC 2 cut(s) 798, 923
RsaNI GTAC 2 cut(s) 797, 922
RseI CAYNNNNRTG 1 cut(s) 1049
SatI GCNGC 4 cut(s) 569, 743, 917, 1030
Sau3AI GATC 4 cut(s) 182, 478, 505, 1120
Sau96I GGNCC 2 cut(s) 173, 393
ScrFI CCNGG 2 cut(s) 171, 872
SetI ASST 9 cut(s) 349, 523, 565, 739, 757, 973, 986, 1164, 1190
SfaNI GCATC 1 cut(s) 874
SfuI TTCGAA 1 cut(s) 839
SinI GGWCC 2 cut(s) 173, 393
SmiMI CAYNNNNRTG 1 cut(s) 1049
SsiI CCGC 3 cut(s) 919, 965, 1029
SspMI CTAG 4 cut(s) 336, 851, 893, 1019
StyD4I CCNGG 2 cut(s) 169, 870
StyI CCWWGG 4 cut(s) 235, 681, 792, 831
TaiI ACGT 1 cut(s) 523
TaqI TCGA 1 cut(s) 839
TauI GCSGC 1 cut(s) 1032
TseFI GTSAC 1 cut(s) 666
TseI GCWGC 3 cut(s) 568, 742, 916
Tsp45I GTSAC 1 cut(s) 666
TspGWI ACGGA 1 cut(s) 32
VpaK11BI GGWCC 2 cut(s) 173, 393
XapI RAATTY 6 cut(s) 97, 604, 633, 649, 842, 878
XcmI CCANNNNNNNNNTGG 1 cut(s) 468
XspI CTAG 4 cut(s) 336, 851, 893, 1019
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.