pycom12575g00030

Nudix hydrolase 3-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00012575
Physical Location & Seq
Forward (+)
70502 .. 73503
3002 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 873 bp
ATGATGTTGAACGCGTTTTCTGAAAAGCCGAGAACGCGTCGCCTAAATTACACCGGAAATTCCGGTTTTTTTGAATTGGTGGACGCGTCGCCTTGGCTTCTTATAGAGGCAAACTCATCGAACCTTAGCTTGGAATTGAGCCTTAGCAGTGATACGGGCGCGCCGCGTCAAGGTAACGTATGGCGCCCTTCTTTCTTATCTTCTAACGGTCTTCTTACAGGTGAAGACTTCGTGATGCAGGACGCCATAACAGCTACAATAGTAGCTAGGAACCTCCTCACTCCAAAAGATAGTAGGCTGCTGTCAGGACGGTCCGATGAGTTGGCCGTTCAAGAGTCCCTCGCACTTAGTGTTCAGTGTGCGAGTTCTGTGTCCAACATGGGCCAACGCCTGCTTGCCCGTTCCCGTCAGGTGGAATCATTGATGGCAGAGGTGGAAAGTCTTAAGCAAGAGATCCAGCAGCTTAAGTACGAGAATAGAAGTTTGCACGTGCTTGCCAACAACTATTCGACGGGCATGAAGAGGAAGCTTGATGAGCTGCAAGAGTCTGAAGGTCGGATTCACAGTGACCGTCAAAGGTTTTCGTCTTTCCTCCAGAGGCACCTTTTTCCTGGCTCATCCAGCGCTTGGCCAAGTATTGAGGCCTGGAATGCTTTAGCTCCGATGCCTCCCGCTCCGATGCCTTCCGCTCCGATGCCTTCCGCTTCGATGCCTTCCGCTCCGATGCCTCGTAGTGGGGCTTCACGTAAACAACCTTTTCCCCTACATGATTGCATAATAGAGATACAAGCAAGAATCATTACGCTCTATGAAAATTATAAGCCAAGAATTCGTTTAACGCGATTGTTTATAAGCAACCTCCACTACTTGTGA

Protein Analysis

291

Amino Acids

32.44

Weight (kDa)

9.17

Isoelectric Point (pI)

60.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 819, 851
AccB1I GGYRCC 2 cut(s) 183, 600
AccB7I CCANNNNNTGG 1 cut(s) 627
AccBSI CCGCTC 3 cut(s) 674, 689, 719
AccII CGCG 6 cut(s) 14, 37, 86, 161, 166, 841
AciI CCGC 5 cut(s) 164, 672, 687, 702, 717
AclWI GGATC 1 cut(s) 448
AcoI YGGCCR 2 cut(s) 324, 629
AcsI RAATTY 2 cut(s) 58, 828
AcuI CTGAAG 1 cut(s) 570
AcvI CACGTG 1 cut(s) 490
AcyI GRCGYC 2 cut(s) 184, 243
AdeI CACNNNGTG 1 cut(s) 350
AfaI GTAC 1 cut(s) 470
AfeI AGCGCT 1 cut(s) 625
AfiI CCNNNNNNNGG 5 cut(s) 130, 170, 412, 627, 734
AflII CTTAAG 2 cut(s) 443, 464
AflIII ACRYGT 3 cut(s) 12, 35, 84
AgsI TTSAA 3 cut(s) 10, 74, 332
AjnI CCWGG 2 cut(s) 610, 644
AjuI GAANNNNNNNTTGG 2 cut(s) 113, 145
AluBI AGCT 7 cut(s) 129, 254, 266, 463, 529, 538, 659
AluI AGCT 7 cut(s) 129, 254, 266, 463, 529, 538, 659
AlwI GGATC 1 cut(s) 448
Aor51HI AGCGCT 1 cut(s) 625
AoxI GGCC 4 cut(s) 324, 382, 629, 642
ApeKI GCWGC 3 cut(s) 298, 460, 538
ApoI RAATTY 2 cut(s) 58, 828
AscI GGCGCGCC 1 cut(s) 159
AspLEI GCGC 4 cut(s) 161, 163, 186, 626
AspS9I GGNCC 2 cut(s) 312, 382
AsuHPI GGTGA 1 cut(s) 233
AvaII GGWCC 1 cut(s) 312
BalI TGGCCA 1 cut(s) 631
BanI GGYRCC 2 cut(s) 183, 600
BarI GAAGNNNNNNTAC 2 cut(s) 724, 756
BbrPI CACGTG 1 cut(s) 490
BbsI GAAGAC 2 cut(s) 203, 231
BbvI GCAGC 3 cut(s) 285, 472, 525
BccI CCATC 1 cut(s) 418
BceAI ACGGC 1 cut(s) 311
BcgI CGANNNNNNTGC 2 cut(s) 99, 133
BciT130I CCWGG 2 cut(s) 612, 646
BfaI CTAG 1 cut(s) 267
BfoI RGCGCY 2 cut(s) 187, 627
BfrI CTTAAG 2 cut(s) 443, 464
BisI GCNGC 4 cut(s) 164, 299, 461, 539
BlsI GCNGC 4 cut(s) 165, 300, 462, 540
Bme1390I CCNGG 2 cut(s) 612, 646
Bme18I GGWCC 1 cut(s) 312
BmgT120I GGNCC 2 cut(s) 312, 382
BmiI GGNNCC 3 cut(s) 185, 272, 602
BmrFI CCNGG 2 cut(s) 612, 646
BmsI GCATC 6 cut(s) 225, 654, 669, 684, 699, 714
BpiI GAAGAC 2 cut(s) 203, 231
BplI GAGNNNNNCTC 2 cut(s) 98, 130
BpmI CTGGAG 1 cut(s) 578
Bpu10I CCTNAGC 2 cut(s) 125, 143
BsaAI YACGTR 2 cut(s) 490, 746
BsaHI GRCGYC 2 cut(s) 184, 243
BsaJI CCNNGG 1 cut(s) 92
BsaWI WCCGGW 2 cut(s) 53, 62
Bsc4I CCNNNNNNNGG 5 cut(s) 130, 170, 412, 627, 734
BseBI CCWGG 2 cut(s) 612, 646
BseDI CCNNGG 1 cut(s) 92
BseGI GGATG 1 cut(s) 617
BseLI CCNNNNNNNGG 5 cut(s) 130, 170, 412, 627, 734
BsePI GCGCGC 1 cut(s) 159
BseRI GAGGAG 1 cut(s) 266
BseXI GCAGC 3 cut(s) 285, 472, 525
Bsh1236I CGCG 6 cut(s) 14, 37, 86, 161, 166, 841
BshFI GGCC 4 cut(s) 326, 384, 631, 644
BshNI GGYRCC 2 cut(s) 183, 600
BsiSI CCGG 2 cut(s) 54, 63
BslFI GGGAC 1 cut(s) 322
BslI CCNNNNNNNGG 5 cut(s) 130, 170, 412, 627, 734
BsmFI GGGAC 1 cut(s) 322
BsmI GAATGC 1 cut(s) 655
BsnI GGCC 4 cut(s) 326, 384, 631, 644
Bsp143I GATC 1 cut(s) 453
BspACI CCGC 5 cut(s) 164, 672, 687, 702, 717
BspANI GGCC 4 cut(s) 326, 384, 631, 644
BspFNI CGCG 6 cut(s) 14, 37, 86, 161, 166, 841
BspLI GGNNCC 3 cut(s) 185, 272, 602
BspPI GGATC 1 cut(s) 448
BspT107I GGYRCC 2 cut(s) 183, 600
BspTI CTTAAG 2 cut(s) 443, 464
BsrBI CCGCTC 3 cut(s) 674, 689, 719
BssECI CCNNGG 1 cut(s) 92
BssHII GCGCGC 1 cut(s) 159
BssMI GATC 1 cut(s) 453
BssNI GRCGYC 2 cut(s) 184, 243
BssT1I CCWWGG 1 cut(s) 92
Bst2UI CCWGG 2 cut(s) 612, 646
Bst4CI ACNGT 4 cut(s) 209, 312, 566, 572
Bst6I CTCTTC 1 cut(s) 515
BstACI GRCGYC 2 cut(s) 184, 243
BstAFI CTTAAG 2 cut(s) 443, 464
BstBAI YACGTR 2 cut(s) 490, 746
BstC8I GCNNGC 4 cut(s) 161, 392, 396, 495
BstDEI CTNAG 3 cut(s) 125, 143, 347
BstF5I GGATG 1 cut(s) 617
BstFNI CGCG 6 cut(s) 14, 37, 86, 161, 166, 841
BstH2I RGCGCY 2 cut(s) 187, 627
BstHHI GCGC 4 cut(s) 161, 163, 186, 626
BstKTI GATC 1 cut(s) 456
BstMBI GATC 1 cut(s) 453
BstMWI GCNNNNNNNGC 5 cut(s) 34, 251, 535, 621, 650
BstNI CCWGG 2 cut(s) 612, 646
BstSCI CCNGG 2 cut(s) 610, 644
BstUI CGCG 6 cut(s) 14, 37, 86, 161, 166, 841
BstV1I GCAGC 3 cut(s) 285, 472, 525
BstV2I GAAGAC 2 cut(s) 203, 231
BstX2I RGATCY 1 cut(s) 453
BstYI RGATCY 1 cut(s) 453
BsuRI GGCC 4 cut(s) 326, 384, 631, 644
BtsCI GGATG 1 cut(s) 617
BtsI GCAGTG 1 cut(s) 154
BtsIMutI CAGTG 3 cut(s) 154, 362, 571
Cac8I GCNNGC 4 cut(s) 161, 392, 396, 495
CfoI GCGC 4 cut(s) 161, 163, 186, 626
Cfr13I GGNCC 2 cut(s) 312, 382
CpoI CGGWCCG 1 cut(s) 312
CseI GACGC 5 cut(s) 26, 75, 92, 155, 251
Csp6I GTAC 1 cut(s) 469
CspI CGGWCCG 1 cut(s) 312
CviAII CATG 3 cut(s) 379, 517, 767
CviQI GTAC 1 cut(s) 469
DdeI CTNAG 3 cut(s) 125, 143, 347
DinI GGCGCC 1 cut(s) 185
DpnI GATC 1 cut(s) 455
DpnII GATC 1 cut(s) 453
DraIII CACNNNGTG 1 cut(s) 350
EaeI YGGCCR 2 cut(s) 324, 629
Eam1104I CTCTTC 1 cut(s) 515
EarI CTCTTC 1 cut(s) 515
Eco130I CCWWGG 1 cut(s) 92
Eco147I AGGCCT 1 cut(s) 644
Eco47I GGWCC 1 cut(s) 312
Eco47III AGCGCT 1 cut(s) 625
Eco57I CTGAAG 1 cut(s) 570
Eco72I CACGTG 1 cut(s) 490
EcoRI GAATTC 1 cut(s) 828
EcoRII CCWGG 2 cut(s) 610, 644
EcoT14I CCWWGG 1 cut(s) 92
EgeI GGCGCC 1 cut(s) 185
EheI GGCGCC 1 cut(s) 185
ErhI CCWWGG 1 cut(s) 92
FaeI CATG 3 cut(s) 382, 520, 770
FaqI GGGAC 1 cut(s) 322
FatI CATG 3 cut(s) 378, 516, 766
FauI CCCGC 1 cut(s) 679
Fnu4HI GCNGC 4 cut(s) 164, 299, 461, 539
FokI GGATG 1 cut(s) 604
Fsp4HI GCNGC 4 cut(s) 164, 299, 461, 539
FspBI CTAG 1 cut(s) 267
GlaI GCGC 4 cut(s) 160, 162, 185, 625
GluI GCNGC 4 cut(s) 164, 299, 461, 539
GsuI CTGGAG 1 cut(s) 578
HaeII RGCGCY 2 cut(s) 187, 627
HaeIII GGCC 4 cut(s) 326, 384, 631, 644
HapII CCGG 2 cut(s) 54, 63
HgaI GACGC 5 cut(s) 26, 75, 92, 155, 251
HhaI GCGC 4 cut(s) 161, 163, 186, 626
Hin1I GRCGYC 2 cut(s) 184, 243
Hin1II CATG 3 cut(s) 382, 520, 770
Hin6I GCGC 4 cut(s) 159, 161, 184, 624
HinP1I GCGC 4 cut(s) 159, 161, 184, 624
HindIII AAGCTT 1 cut(s) 527
HinfI GANTC 5 cut(s) 335, 416, 545, 559, 795
HpaII CCGG 2 cut(s) 54, 63
HphI GGTGA 1 cut(s) 233
Hpy166II GTNNAC 2 cut(s) 82, 749
Hpy188I TCNGA 8 cut(s) 22, 316, 550, 558, 663, 678, 693, 723
Hpy188III TCNNGA 4 cut(s) 232, 306, 332, 595
Hpy8I GTNNAC 2 cut(s) 82, 749
Hpy99I CGWCG 3 cut(s) 42, 91, 514
HpyAV CCTTC 5 cut(s) 198, 545, 693, 708, 723
HpyCH4III ACNGT 4 cut(s) 209, 312, 566, 572
HpyCH4IV ACGT 3 cut(s) 177, 489, 745
HpyCH4V TGCA 4 cut(s) 238, 487, 541, 774
HpyF10VI GCNNNNNNNGC 5 cut(s) 34, 251, 535, 621, 650
HpyF3I CTNAG 3 cut(s) 125, 143, 347
HpySE526I ACGT 3 cut(s) 177, 489, 745
Hsp92I GRCGYC 2 cut(s) 184, 243
Hsp92II CATG 3 cut(s) 382, 520, 770
HspAI GCGC 4 cut(s) 159, 161, 184, 624
KasI GGCGCC 1 cut(s) 183
Kzo9I GATC 1 cut(s) 453
LmnI GCTCC 4 cut(s) 664, 679, 694, 724
Lsp1109I GCAGC 3 cut(s) 285, 472, 525
LweI GCATC 6 cut(s) 225, 654, 669, 684, 699, 714
MaeI CTAG 1 cut(s) 267
MaeII ACGT 3 cut(s) 177, 489, 745
MaeIII GTNAC 2 cut(s) 173, 566
MalI GATC 1 cut(s) 455
MbiI CCGCTC 3 cut(s) 674, 689, 719
MboI GATC 1 cut(s) 453
MboII GAAGA 4 cut(s) 192, 203, 236, 532
MflI RGATCY 1 cut(s) 453
MlsI TGGCCA 1 cut(s) 631
MluCI AATT 6 cut(s) 46, 58, 74, 134, 814, 828
MluI ACGCGT 3 cut(s) 12, 35, 84
MluNI TGGCCA 1 cut(s) 631
Mly113I GGCGCC 1 cut(s) 184
MlyI GAGTC 2 cut(s) 344, 554
MmeI TCCRAC 2 cut(s) 399, 536
Mox20I TGGCCA 1 cut(s) 631
MscI TGGCCA 1 cut(s) 631
MseI TTAA 3 cut(s) 444, 465, 836
Msp20I TGGCCA 1 cut(s) 631
MspCI CTTAAG 2 cut(s) 443, 464
MspI CCGG 2 cut(s) 54, 63
MspR9I CCNGG 2 cut(s) 612, 646
Mva1269I GAATGC 1 cut(s) 655
MvaI CCWGG 2 cut(s) 612, 646
MvnI CGCG 6 cut(s) 14, 37, 86, 161, 166, 841
MwoI GCNNNNNNNGC 5 cut(s) 34, 251, 535, 621, 650
NarI GGCGCC 1 cut(s) 184
NdeII GATC 1 cut(s) 453
NlaIII CATG 3 cut(s) 382, 520, 770
NlaIV GGNNCC 3 cut(s) 185, 272, 602
NmeAIII GCCGAG 1 cut(s) 54
NmuCI GTSAC 1 cut(s) 566
PalAI GGCGCGCC 1 cut(s) 159
PauI GCGCGC 1 cut(s) 159
PceI AGGCCT 1 cut(s) 644
PcsI WCGNNNNNNNCGW 1 cut(s) 838
PctI GAATGC 1 cut(s) 655
PfeI GAWTC 3 cut(s) 416, 559, 795
PflMI CCANNNNNTGG 1 cut(s) 627
PkrI GCNGC 4 cut(s) 165, 300, 462, 540
PleI GAGTC 2 cut(s) 343, 553
PluTI GGCGCC 1 cut(s) 187
PmaCI CACGTG 1 cut(s) 490
PmlI CACGTG 1 cut(s) 490
PpsI GAGTC 2 cut(s) 343, 553
Ppu21I YACGTR 2 cut(s) 490, 746
PsiI TTATAA 2 cut(s) 819, 851
Psp6I CCWGG 2 cut(s) 610, 644
PspCI CACGTG 1 cut(s) 490
PspGI CCWGG 2 cut(s) 610, 644
PspN4I GGNNCC 3 cut(s) 185, 272, 602
PspPI GGNCC 2 cut(s) 312, 382
PsuI RGATCY 1 cut(s) 453
PteI GCGCGC 1 cut(s) 159
RsaI GTAC 1 cut(s) 470
RsaNI GTAC 1 cut(s) 469
Rsr2I CGGWCCG 1 cut(s) 312
RsrII CGGWCCG 1 cut(s) 312
SaqAI TTAA 3 cut(s) 444, 465, 836
SatI GCNGC 4 cut(s) 164, 299, 461, 539
Sau3AI GATC 1 cut(s) 453
Sau96I GGNCC 2 cut(s) 312, 382
SchI GAGTC 2 cut(s) 344, 554
ScrFI CCNGG 2 cut(s) 612, 646
SfaNI GCATC 6 cut(s) 225, 654, 669, 684, 699, 714
SfoI GGCGCC 1 cut(s) 185
SgsI GGCGCGCC 1 cut(s) 159
SinI GGWCC 1 cut(s) 312
SmlI CTYRAG 2 cut(s) 443, 464
SmoI CTYRAG 2 cut(s) 443, 464
Sse9I AATT 6 cut(s) 46, 58, 74, 134, 814, 828
SseBI AGGCCT 1 cut(s) 644
SsiI CCGC 5 cut(s) 164, 672, 687, 702, 717
SspDI GGCGCC 1 cut(s) 183
SspMI CTAG 1 cut(s) 267
StuI AGGCCT 1 cut(s) 644
StyD4I CCNGG 2 cut(s) 610, 644
StyI CCWWGG 1 cut(s) 92
TaaI ACNGT 4 cut(s) 209, 312, 566, 572
TaiI ACGT 3 cut(s) 180, 492, 748
TaqI TCGA 3 cut(s) 119, 509, 707
TasI AATT 6 cut(s) 46, 58, 74, 134, 814, 828
TauI GCSGC 1 cut(s) 166
TfiI GAWTC 3 cut(s) 416, 559, 795
Tru1I TTAA 3 cut(s) 444, 465, 836
Tru9I TTAA 3 cut(s) 444, 465, 836
TscAI CASTG 3 cut(s) 154, 362, 571
TseFI GTSAC 1 cut(s) 566
TseI GCWGC 3 cut(s) 298, 460, 538
Tsp45I GTSAC 1 cut(s) 566
TspDTI ATGAA 2 cut(s) 533, 825
TspRI CASTG 3 cut(s) 154, 362, 571
Van91I CCANNNNNTGG 1 cut(s) 627
Vha464I CTTAAG 2 cut(s) 443, 464
VpaK11BI GGWCC 1 cut(s) 312
XapI RAATTY 2 cut(s) 58, 828
XspI CTAG 1 cut(s) 267
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.