pycom12633g00040

Nudix hydrolase 3-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00012633
Physical Location & Seq
Forward (+)
90591 .. 101573
10983 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 723 bp
ATGGAGGCAAACTCATCGAACCTTAGCTTGGAATTGAGCCTTAGCAGTGATACGGGCGCGCCGCGTCAAGGTAACGTATGGAGCCCTTCTTTCTTATCTTCTAACGGTCTTCTTACAGGTGAAGACTCCGTGATGCAGGACGCCACAACAGCTACAATAGTAGCTAGGAACCTCCTCACTCCAAAAGATAGTAGGCTGCTGTCAGGACGGTCCGATGAGTTGGCCGTTCAAGAGTCCCTCGCACTTAGTGTTCAGTGTGCGAGTTCTGTGTCCAACATGGGCCAACGCCTACTTGCCCGCTCCCCTCAGGTGGAATCATTGATGGCAGAGGTGGAGAGTCTTAAGCAAGAGATCCAGCAGCTTAAGTACGAGAATAGAAGTTTGCATGTGCTTGCAAATAACTATTCGTCGGGCATGAAGAGGAAGCTTGATGAGCTGCAAGAATCTGAGGGTCGAATTCACAGTGACCGTCAAAGGTTTTCGTCTTTCCTCCAGAGGCATCTTCTTCCTGGATCATCGAGCGCTTGGCCAAGTATTGAGGCCTGGAATGCTCTAGCTTCGATGCCTTCTGCTTCTGCGCCTCGTAGTGGGGCTTCACGTAAACAACCTTTGAAGGTATGGTGGGGAAGAGTGATGGAAATGGAAAGATGGTTTTGGATTCTAAGGGGACTCACGGCAAAGAGAAGGAATGGAAGTGTTTGTGGTGTGTTGTGTATGAAATGA

Protein Analysis

241

Amino Acids

26.54

Weight (kDa)

9.33

Isoelectric Point (pI)

61.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 300
AccII CGCG 2 cut(s) 59, 64
AciI CCGC 2 cut(s) 62, 298
AclWI GGATC 2 cut(s) 346, 520
AcoI YGGCCR 2 cut(s) 222, 527
AcsI RAATTY 1 cut(s) 456
AcyI GRCGYC 1 cut(s) 141
AdeI CACNNNGTG 1 cut(s) 248
AfaI GTAC 1 cut(s) 368
AfeI AGCGCT 1 cut(s) 523
AfiI CCNNNNNNNGG 4 cut(s) 28, 68, 310, 587
AflII CTTAAG 2 cut(s) 341, 362
AgsI TTSAA 2 cut(s) 230, 613
AjnI CCWGG 2 cut(s) 508, 542
AjuI GAANNNNNNNTTGG 2 cut(s) 11, 43
AluBI AGCT 7 cut(s) 27, 152, 164, 361, 427, 436, 557
AluI AGCT 7 cut(s) 27, 152, 164, 361, 427, 436, 557
AlwI GGATC 2 cut(s) 346, 520
Aor51HI AGCGCT 1 cut(s) 523
AoxI GGCC 4 cut(s) 222, 280, 527, 540
ApeKI GCWGC 3 cut(s) 196, 358, 436
ApoI RAATTY 1 cut(s) 456
AscI GGCGCGCC 1 cut(s) 57
AspLEI GCGC 4 cut(s) 59, 61, 524, 580
AspS9I GGNCC 2 cut(s) 210, 280
AsuHPI GGTGA 1 cut(s) 131
AvaII GGWCC 1 cut(s) 210
AxyI CCTNAGG 1 cut(s) 306
BalI TGGCCA 1 cut(s) 529
BanII GRGCYC 1 cut(s) 86
BarI GAAGNNNNNNTAC 2 cut(s) 577, 609
BbsI GAAGAC 2 cut(s) 101, 129
BbvI GCAGC 3 cut(s) 183, 370, 423
BccI CCATC 3 cut(s) 316, 628, 642
BceAI ACGGC 2 cut(s) 209, 690
BcgI CGANNNNNNTGC 1 cut(s) 31
BciT130I CCWGG 2 cut(s) 510, 544
BfaI CTAG 2 cut(s) 165, 554
BfoI RGCGCY 1 cut(s) 525
BfrI CTTAAG 2 cut(s) 341, 362
BisI GCNGC 4 cut(s) 62, 197, 359, 437
BlsI GCNGC 4 cut(s) 63, 198, 360, 438
Bme1390I CCNGG 2 cut(s) 510, 544
Bme18I GGWCC 1 cut(s) 210
BmgT120I GGNCC 2 cut(s) 210, 280
BmiI GGNNCC 2 cut(s) 83, 170
BmrFI CCNGG 2 cut(s) 510, 544
BmsI GCATC 3 cut(s) 123, 508, 552
BpiI GAAGAC 2 cut(s) 101, 129
BplI GAGNNNNNCTC 1 cut(s) 28
BpmI CTGGAG 1 cut(s) 476
Bpu10I CCTNAGC 2 cut(s) 23, 41
BsaAI YACGTR 1 cut(s) 599
BsaHI GRCGYC 1 cut(s) 141
Bsc4I CCNNNNNNNGG 4 cut(s) 28, 68, 310, 587
Bse21I CCTNAGG 1 cut(s) 306
BseBI CCWGG 2 cut(s) 510, 544
BseLI CCNNNNNNNGG 4 cut(s) 28, 68, 310, 587
BseMII CTCAG 2 cut(s) 320, 438
BsePI GCGCGC 1 cut(s) 57
BseRI GAGGAG 1 cut(s) 164
BseXI GCAGC 3 cut(s) 183, 370, 423
Bsh1236I CGCG 2 cut(s) 59, 64
BshFI GGCC 4 cut(s) 224, 282, 529, 542
BslFI GGGAC 2 cut(s) 220, 681
BslI CCNNNNNNNGG 4 cut(s) 28, 68, 310, 587
BsmFI GGGAC 2 cut(s) 220, 681
BsmI GAATGC 1 cut(s) 553
BsnI GGCC 4 cut(s) 224, 282, 529, 542
Bsp1286I GDGCHC 1 cut(s) 86
Bsp143I GATC 2 cut(s) 351, 512
BspACI CCGC 2 cut(s) 62, 298
BspANI GGCC 4 cut(s) 224, 282, 529, 542
BspCNI CTCAG 2 cut(s) 319, 439
BspFNI CGCG 2 cut(s) 59, 64
BspLI GGNNCC 2 cut(s) 83, 170
BspPI GGATC 2 cut(s) 346, 520
BspTI CTTAAG 2 cut(s) 341, 362
BsrBI CCGCTC 1 cut(s) 300
BssHII GCGCGC 1 cut(s) 57
BssMI GATC 2 cut(s) 351, 512
BssNI GRCGYC 1 cut(s) 141
Bst2UI CCWGG 2 cut(s) 510, 544
Bst4CI ACNGT 4 cut(s) 107, 210, 464, 470
Bst6I CTCTTC 2 cut(s) 413, 622
BstACI GRCGYC 1 cut(s) 141
BstAFI CTTAAG 2 cut(s) 341, 362
BstBAI YACGTR 1 cut(s) 599
BstC8I GCNNGC 3 cut(s) 59, 298, 393
BstDEI CTNAG 6 cut(s) 23, 41, 245, 306, 447, 662
BstFNI CGCG 2 cut(s) 59, 64
BstH2I RGCGCY 1 cut(s) 525
BstHHI GCGC 4 cut(s) 59, 61, 524, 580
BstKTI GATC 2 cut(s) 354, 515
BstMBI GATC 2 cut(s) 351, 512
BstMWI GCNNNNNNNGC 3 cut(s) 149, 433, 548
BstNI CCWGG 2 cut(s) 510, 544
BstNSI RCATGY 1 cut(s) 389
BstSCI CCNGG 2 cut(s) 508, 542
BstUI CGCG 2 cut(s) 59, 64
BstV1I GCAGC 3 cut(s) 183, 370, 423
BstV2I GAAGAC 2 cut(s) 101, 129
BstX2I RGATCY 1 cut(s) 351
BstYI RGATCY 1 cut(s) 351
Bsu36I CCTNAGG 1 cut(s) 306
BsuRI GGCC 4 cut(s) 224, 282, 529, 542
BtsI GCAGTG 1 cut(s) 52
BtsIMutI CAGTG 3 cut(s) 52, 260, 469
Cac8I GCNNGC 3 cut(s) 59, 298, 393
CfoI GCGC 4 cut(s) 59, 61, 524, 580
Cfr13I GGNCC 2 cut(s) 210, 280
CpoI CGGWCCG 1 cut(s) 210
CseI GACGC 2 cut(s) 53, 149
Csp6I GTAC 1 cut(s) 367
CspI CGGWCCG 1 cut(s) 210
CviAII CATG 3 cut(s) 277, 386, 415
CviQI GTAC 1 cut(s) 367
DdeI CTNAG 6 cut(s) 23, 41, 245, 306, 447, 662
DpnI GATC 2 cut(s) 353, 514
DpnII GATC 2 cut(s) 351, 512
DraIII CACNNNGTG 1 cut(s) 248
EaeI YGGCCR 2 cut(s) 222, 527
Eam1104I CTCTTC 2 cut(s) 413, 622
EarI CTCTTC 2 cut(s) 413, 622
Eco147I AGGCCT 1 cut(s) 542
Eco24I GRGCYC 1 cut(s) 86
Eco47I GGWCC 1 cut(s) 210
Eco47III AGCGCT 1 cut(s) 523
Eco81I CCTNAGG 1 cut(s) 306
EcoRI GAATTC 1 cut(s) 456
EcoRII CCWGG 2 cut(s) 508, 542
EcoT38I GRGCYC 1 cut(s) 86
FaeI CATG 3 cut(s) 280, 389, 418
FaiI YATR 6 cut(s) 79, 278, 387, 416, 619, 716
FaqI GGGAC 2 cut(s) 220, 681
FatI CATG 3 cut(s) 276, 385, 414
FauI CCCGC 1 cut(s) 305
Fnu4HI GCNGC 4 cut(s) 62, 197, 359, 437
FriOI GRGCYC 1 cut(s) 86
Fsp4HI GCNGC 4 cut(s) 62, 197, 359, 437
FspBI CTAG 2 cut(s) 165, 554
GlaI GCGC 4 cut(s) 58, 60, 523, 579
GluI GCNGC 4 cut(s) 62, 197, 359, 437
GsuI CTGGAG 1 cut(s) 476
HaeII RGCGCY 1 cut(s) 525
HaeIII GGCC 4 cut(s) 224, 282, 529, 542
HgaI GACGC 2 cut(s) 53, 149
HhaI GCGC 4 cut(s) 59, 61, 524, 580
Hin1I GRCGYC 1 cut(s) 141
Hin1II CATG 3 cut(s) 280, 389, 418
Hin6I GCGC 4 cut(s) 57, 59, 522, 578
HinP1I GCGC 4 cut(s) 57, 59, 522, 578
HindIII AAGCTT 1 cut(s) 425
HinfI GANTC 7 cut(s) 125, 233, 314, 337, 443, 658, 669
HphI GGTGA 1 cut(s) 131
Hpy166II GTNNAC 1 cut(s) 602
Hpy188I TCNGA 2 cut(s) 214, 448
Hpy188III TCNNGA 3 cut(s) 204, 230, 493
Hpy8I GTNNAC 1 cut(s) 602
Hpy99I CGWCG 1 cut(s) 412
HpyAV CCTTC 4 cut(s) 96, 576, 607, 678
HpyCH4III ACNGT 4 cut(s) 107, 210, 464, 470
HpyCH4IV ACGT 2 cut(s) 75, 598
HpyCH4V TGCA 4 cut(s) 136, 385, 395, 439
HpyF10VI GCNNNNNNNGC 3 cut(s) 149, 433, 548
HpyF3I CTNAG 6 cut(s) 23, 41, 245, 306, 447, 662
HpySE526I ACGT 2 cut(s) 75, 598
Hsp92I GRCGYC 1 cut(s) 141
Hsp92II CATG 3 cut(s) 280, 389, 418
HspAI GCGC 4 cut(s) 57, 59, 522, 578
Kzo9I GATC 2 cut(s) 351, 512
LmnI GCTCC 2 cut(s) 81, 305
Lsp1109I GCAGC 3 cut(s) 183, 370, 423
LweI GCATC 3 cut(s) 123, 508, 552
MaeI CTAG 2 cut(s) 165, 554
MaeII ACGT 2 cut(s) 75, 598
MaeIII GTNAC 2 cut(s) 71, 464
MalI GATC 2 cut(s) 353, 514
MbiI CCGCTC 1 cut(s) 300
MboI GATC 2 cut(s) 351, 512
MboII GAAGA 7 cut(s) 90, 101, 134, 430, 494, 497, 639
MflI RGATCY 1 cut(s) 351
MhlI GDGCHC 1 cut(s) 86
MlsI TGGCCA 1 cut(s) 529
MluCI AATT 2 cut(s) 32, 456
MluNI TGGCCA 1 cut(s) 529
MlyI GAGTC 4 cut(s) 119, 242, 346, 663
MmeI TCCRAC 1 cut(s) 297
Mox20I TGGCCA 1 cut(s) 529
MscI TGGCCA 1 cut(s) 529
MseI TTAA 2 cut(s) 342, 363
Msp20I TGGCCA 1 cut(s) 529
MspCI CTTAAG 2 cut(s) 341, 362
MspR9I CCNGG 2 cut(s) 510, 544
Mva1269I GAATGC 1 cut(s) 553
MvaI CCWGG 2 cut(s) 510, 544
MvnI CGCG 2 cut(s) 59, 64
MwoI GCNNNNNNNGC 3 cut(s) 149, 433, 548
NdeII GATC 2 cut(s) 351, 512
NlaIII CATG 3 cut(s) 280, 389, 418
NlaIV GGNNCC 2 cut(s) 83, 170
NmuCI GTSAC 1 cut(s) 464
NspI RCATGY 1 cut(s) 389
PalAI GGCGCGCC 1 cut(s) 57
PauI GCGCGC 1 cut(s) 57
PceI AGGCCT 1 cut(s) 542
PctI GAATGC 1 cut(s) 553
PfeI GAWTC 3 cut(s) 314, 443, 658
PfoI TCCNGGA 1 cut(s) 508
PkrI GCNGC 4 cut(s) 63, 198, 360, 438
PleI GAGTC 4 cut(s) 119, 241, 345, 663
PpsI GAGTC 4 cut(s) 119, 241, 345, 663
Ppu21I YACGTR 1 cut(s) 599
Psp6I CCWGG 2 cut(s) 508, 542
PspGI CCWGG 2 cut(s) 508, 542
PspN4I GGNNCC 2 cut(s) 83, 170
PspPI GGNCC 2 cut(s) 210, 280
PsuI RGATCY 1 cut(s) 351
PteI GCGCGC 1 cut(s) 57
RsaI GTAC 1 cut(s) 368
RsaNI GTAC 1 cut(s) 367
Rsr2I CGGWCCG 1 cut(s) 210
RsrII CGGWCCG 1 cut(s) 210
SaqAI TTAA 2 cut(s) 342, 363
SatI GCNGC 4 cut(s) 62, 197, 359, 437
Sau3AI GATC 2 cut(s) 351, 512
Sau96I GGNCC 2 cut(s) 210, 280
SchI GAGTC 4 cut(s) 119, 242, 346, 663
ScrFI CCNGG 2 cut(s) 510, 544
SduI GDGCHC 1 cut(s) 86
SfaNI GCATC 3 cut(s) 123, 508, 552
SgsI GGCGCGCC 1 cut(s) 57
SinI GGWCC 1 cut(s) 210
SmlI CTYRAG 2 cut(s) 341, 362
SmoI CTYRAG 2 cut(s) 341, 362
Sse9I AATT 2 cut(s) 32, 456
SseBI AGGCCT 1 cut(s) 542
SsiI CCGC 2 cut(s) 62, 298
SspMI CTAG 2 cut(s) 165, 554
StuI AGGCCT 1 cut(s) 542
StyD4I CCNGG 2 cut(s) 508, 542
TaaI ACNGT 4 cut(s) 107, 210, 464, 470
TaiI ACGT 2 cut(s) 78, 601
TaqI TCGA 4 cut(s) 17, 454, 518, 560
TasI AATT 2 cut(s) 32, 456
TauI GCSGC 1 cut(s) 64
TfiI GAWTC 3 cut(s) 314, 443, 658
Tru1I TTAA 2 cut(s) 342, 363
Tru9I TTAA 2 cut(s) 342, 363
TscAI CASTG 3 cut(s) 52, 260, 469
TseFI GTSAC 1 cut(s) 464
TseI GCWGC 3 cut(s) 196, 358, 436
Tsp45I GTSAC 1 cut(s) 464
TspDTI ATGAA 1 cut(s) 431
TspGWI ACGGA 1 cut(s) 118
TspRI CASTG 3 cut(s) 52, 260, 469
Vha464I CTTAAG 2 cut(s) 341, 362
VpaK11BI GGWCC 1 cut(s) 210
XapI RAATTY 1 cut(s) 456
XceI RCATGY 1 cut(s) 389
XspI CTAG 2 cut(s) 165, 554
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.