pycom12637g00020

Chloroplast-localized elongation factor EF-G involved in protein synthesis in plastids. Catalyzes the GTP-dependent ribosomal translocation step during translation elongation. During this step, the ribosome changes from the pre-translocational (PRE) to the post-translocational (POST) state as the newly formed A- site-bound peptidyl-tRNA and P-site-bound deacylated tRNA move to the P and E sites, respectively. Catalyzes the coordinated movement of the two tRNA molecules, the mRNA and conformational changes in the ribosome

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00012637
Physical Location & Seq
Forward (+)
57344 .. 58060
717 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 717 bp
ATGGAGGTTGGAGCTGACCTAAAAATGTCCAAACATAGCCTAGAAGTGGATGAGGAGCTGCTAATTGAGGAGGAGGAAGAAGACATGCACAGGGCAAGGGTAGAACAACCCTTGCCGCAGCCCCCTAAGCCCTATAAACCACCCACCACAAGTAAGGACGTCCCAATTTCATGTTATTCTGATGTTATTCCACCCAATGTCCCTTTTCCTAGCAGGTTTTTGATTCCCAACCAAGAAGGGAGTAAAAAGGACATCGTGGAAGCCTTCCCAAAGGTGCAGAATGCTATTCCAATTCTTGGTGCAACACAGCAAGTTTTAGATGGTGTTGAATTCTTCAAAGGACTTTGTACACCAAGAAGAATGATTCAAGAGAAGGTAGTGGCTGGAGAAGATGTAGAAGGCATCAAAGAGGACATATTTGAAACCACAAAACCCAAAGAAGTTGAATTTGATGACATTGGACAAGTCATAACCATTACATGCAATCTGGCCAAGTCCAATATCCCTGAAACTTTCAAAGGAGTGGTGTTTGTCATTGAGTTCTTGTCGGACAAAACAAGTAAGTCATCTTCTCCAAATTCCATTACATTTTATACTAACTGGCTGATTTTGATGAATCAGGCACCTACATTAGAATTCAAACCAATGCCGGTTCACTTCAAGTATCACCTTCCATTCAAGGATCCATTCTATGCCGTGAGCCCTAGTGGAGATTAA

Protein Analysis

239

Amino Acids

26.81

Weight (kDa)

4.88

Isoelectric Point (pI)

56.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 162
Acc36I ACCTGC 1 cut(s) 204
AccB1I GGYRCC 1 cut(s) 622
AccB7I CCANNNNNTGG 1 cut(s) 296
AciI CCGC 1 cut(s) 116
AclWI GGATC 2 cut(s) 677, 690
AcoI YGGCCR 1 cut(s) 489
AcsI RAATTY 4 cut(s) 329, 446, 577, 635
AcyI GRCGYC 1 cut(s) 159
AfaI GTAC 1 cut(s) 349
AfiI CCNNNNNNNGG 2 cut(s) 46, 296
AgsI TTSAA 9 cut(s) 329, 337, 368, 422, 446, 517, 640, 661, 679
AluBI AGCT 2 cut(s) 14, 58
AluI AGCT 2 cut(s) 14, 58
AlwI GGATC 2 cut(s) 677, 690
AoxI GGCC 1 cut(s) 489
ApeKI GCWGC 2 cut(s) 58, 118
ApoI RAATTY 4 cut(s) 329, 446, 577, 635
AsuHPI GGTGA 1 cut(s) 659
BalI TGGCCA 1 cut(s) 491
BamHI GGATCC 1 cut(s) 682
BanI GGYRCC 1 cut(s) 622
BanII GRGCYC 1 cut(s) 704
BarI GAAGNNNNNNTAC 2 cut(s) 553, 585
BbsI GAAGAC 1 cut(s) 87
BbvI GCAGC 2 cut(s) 45, 130
BccI CCATC 1 cut(s) 314
BceAI ACGGC 1 cut(s) 680
BfaI CTAG 3 cut(s) 41, 210, 705
BfuAI ACCTGC 1 cut(s) 204
BisI GCNGC 3 cut(s) 59, 116, 119
BlsI GCNGC 3 cut(s) 60, 117, 120
BmiI GGNNCC 2 cut(s) 624, 684
BmsI GCATC 1 cut(s) 411
BpiI GAAGAC 1 cut(s) 87
BpmI CTGGAG 1 cut(s) 405
Bpu10I CCTNAGC 1 cut(s) 126
BsaHI GRCGYC 1 cut(s) 159
BsaXI ACNNNNNCTCC 2 cut(s) 378, 408
Bsc4I CCNNNNNNNGG 2 cut(s) 46, 296
Bse118I RCCGGY 1 cut(s) 649
Bse1I ACTGG 1 cut(s) 605
BseGI GGATG 1 cut(s) 55
BseLI CCNNNNNNNGG 2 cut(s) 46, 296
BseNI ACTGG 1 cut(s) 605
BseRI GAGGAG 3 cut(s) 68, 83, 86
BseXI GCAGC 2 cut(s) 45, 130
BsgI GTGCAG 1 cut(s) 296
BshFI GGCC 1 cut(s) 491
BshNI GGYRCC 1 cut(s) 622
BsiSI CCGG 1 cut(s) 650
BslFI GGGAC 2 cut(s) 146, 185
BslI CCNNNNNNNGG 2 cut(s) 46, 296
BsmFI GGGAC 2 cut(s) 146, 185
BsmI GAATGC 1 cut(s) 286
BsnI GGCC 1 cut(s) 491
Bsp1286I GDGCHC 1 cut(s) 704
Bsp1407I TGTACA 1 cut(s) 347
Bsp143I GATC 1 cut(s) 682
BspACI CCGC 1 cut(s) 116
BspANI GGCC 1 cut(s) 491
BspLI GGNNCC 2 cut(s) 624, 684
BspMI ACCTGC 1 cut(s) 204
BspPI GGATC 2 cut(s) 677, 690
BspT107I GGYRCC 1 cut(s) 622
BsrFI RCCGGY 1 cut(s) 649
BsrGI TGTACA 1 cut(s) 347
BsrI ACTGG 1 cut(s) 605
BssAI RCCGGY 1 cut(s) 649
BssMI GATC 1 cut(s) 682
BssNI GRCGYC 1 cut(s) 159
BstACI GRCGYC 1 cut(s) 159
BstAUI TGTACA 1 cut(s) 347
BstDEI CTNAG 1 cut(s) 126
BstF5I GGATG 1 cut(s) 55
BstKTI GATC 1 cut(s) 685
BstMBI GATC 1 cut(s) 682
BstMWI GCNNNNNNNGC 1 cut(s) 127
BstNSI RCATGY 2 cut(s) 88, 483
BstV1I GCAGC 2 cut(s) 45, 130
BstV2I GAAGAC 1 cut(s) 87
BstX2I RGATCY 1 cut(s) 682
BstYI RGATCY 1 cut(s) 682
BsuRI GGCC 1 cut(s) 491
BtsCI GGATG 1 cut(s) 55
BveI ACCTGC 1 cut(s) 204
Cfr10I RCCGGY 1 cut(s) 649
Csp6I GTAC 1 cut(s) 348
CviAII CATG 3 cut(s) 85, 171, 480
CviQI GTAC 1 cut(s) 348
DdeI CTNAG 1 cut(s) 126
DpnI GATC 1 cut(s) 684
DpnII GATC 1 cut(s) 682
EaeI YGGCCR 1 cut(s) 489
Eco24I GRGCYC 1 cut(s) 704
EcoRI GAATTC 2 cut(s) 329, 635
EcoT38I GRGCYC 1 cut(s) 704
FaeI CATG 3 cut(s) 88, 174, 483
FaiI YATR 9 cut(s) 36, 86, 135, 172, 416, 470, 481, 594, 693
FaqI GGGAC 2 cut(s) 146, 185
FatI CATG 3 cut(s) 84, 170, 479
Fnu4HI GCNGC 3 cut(s) 59, 116, 119
FokI GGATG 1 cut(s) 62
FriOI GRGCYC 1 cut(s) 704
Fsp4HI GCNGC 3 cut(s) 59, 116, 119
FspBI CTAG 3 cut(s) 41, 210, 705
GluI GCNGC 3 cut(s) 59, 116, 119
GsuI CTGGAG 1 cut(s) 405
HaeIII GGCC 1 cut(s) 491
HapII CCGG 1 cut(s) 650
Hin1I GRCGYC 1 cut(s) 159
Hin1II CATG 3 cut(s) 88, 174, 483
HinfI GANTC 3 cut(s) 223, 364, 616
HpaII CCGG 1 cut(s) 650
HphI GGTGA 1 cut(s) 659
Hpy166II GTNNAC 2 cut(s) 350, 655
Hpy188I TCNGA 2 cut(s) 181, 550
Hpy188III TCNNGA 1 cut(s) 368
Hpy8I GTNNAC 2 cut(s) 350, 655
HpyAV CCTTC 5 cut(s) 230, 274, 367, 392, 680
HpyCH4IV ACGT 1 cut(s) 159
HpyCH4V TGCA 4 cut(s) 88, 277, 302, 483
HpyF10VI GCNNNNNNNGC 1 cut(s) 127
HpyF3I CTNAG 1 cut(s) 126
HpySE526I ACGT 1 cut(s) 159
Hsp92I GRCGYC 1 cut(s) 159
Hsp92II CATG 3 cut(s) 88, 174, 483
Kzo9I GATC 1 cut(s) 682
LmnI GCTCC 2 cut(s) 11, 55
LpnPI CCDG 8 cut(s) 76, 199, 369, 473, 519, 586, 605, 663
Lsp1109I GCAGC 2 cut(s) 45, 130
LweI GCATC 1 cut(s) 411
MaeI CTAG 3 cut(s) 41, 210, 705
MaeII ACGT 1 cut(s) 159
MalI GATC 1 cut(s) 684
MboI GATC 1 cut(s) 682
MboII GAAGA 6 cut(s) 89, 92, 325, 369, 401, 561
MflI RGATCY 1 cut(s) 682
MhlI GDGCHC 1 cut(s) 704
MlsI TGGCCA 1 cut(s) 491
MluCI AATT 7 cut(s) 63, 165, 291, 329, 446, 577, 635
MluNI TGGCCA 1 cut(s) 491
MmeI TCCRAC 1 cut(s) 528
MnlI CCTC 5 cut(s) 46, 61, 64, 67, 403
Mox20I TGGCCA 1 cut(s) 491
MscI TGGCCA 1 cut(s) 491
MseI TTAA 1 cut(s) 715
Msp20I TGGCCA 1 cut(s) 491
MspI CCGG 1 cut(s) 650
Mva1269I GAATGC 1 cut(s) 286
MwoI GCNNNNNNNGC 1 cut(s) 127
NdeII GATC 1 cut(s) 682
NlaIII CATG 3 cut(s) 88, 174, 483
NlaIV GGNNCC 2 cut(s) 624, 684
NspI RCATGY 2 cut(s) 88, 483
PctI GAATGC 1 cut(s) 286
PfeI GAWTC 3 cut(s) 223, 364, 616
PflMI CCANNNNNTGG 1 cut(s) 296
PkrI GCNGC 3 cut(s) 60, 117, 120
PspN4I GGNNCC 2 cut(s) 624, 684
PsuI RGATCY 1 cut(s) 682
RsaI GTAC 1 cut(s) 349
RsaNI GTAC 1 cut(s) 348
SaqAI TTAA 1 cut(s) 715
SatI GCNGC 3 cut(s) 59, 116, 119
Sau3AI GATC 1 cut(s) 682
SduI GDGCHC 1 cut(s) 704
SfaNI GCATC 1 cut(s) 411
Sse9I AATT 7 cut(s) 63, 165, 291, 329, 446, 577, 635
SsiI CCGC 1 cut(s) 116
SspMI CTAG 3 cut(s) 41, 210, 705
TaiI ACGT 1 cut(s) 162
TasI AATT 7 cut(s) 63, 165, 291, 329, 446, 577, 635
TatI WGTACW 1 cut(s) 347
TauI GCSGC 1 cut(s) 118
TfiI GAWTC 3 cut(s) 223, 364, 616
Tru1I TTAA 1 cut(s) 715
Tru9I TTAA 1 cut(s) 715
TseI GCWGC 2 cut(s) 58, 118
TspDTI ATGAA 2 cut(s) 159, 629
Van91I CCANNNNNTGG 1 cut(s) 296
XapI RAATTY 4 cut(s) 329, 446, 577, 635
XceI RCATGY 2 cut(s) 88, 483
XspI CTAG 3 cut(s) 41, 210, 705
ZraI GACGTC 1 cut(s) 160
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.