pycom12658g00010

Chloroplast-localized elongation factor EF-G involved in protein synthesis in plastids. Catalyzes the GTP-dependent ribosomal translocation step during translation elongation. During this step, the ribosome changes from the pre-translocational (PRE) to the post-translocational (POST) state as the newly formed A- site-bound peptidyl-tRNA and P-site-bound deacylated tRNA move to the P and E sites, respectively. Catalyzes the coordinated movement of the two tRNA molecules, the mRNA and conformational changes in the ribosome

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00012658
Physical Location & Seq
Forward (+)
3549 .. 4590
1042 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 858 bp
ATGGAGGTTGGAGCTGACCTAAAAATGTCCAAACATAGCCTAGAAGTGGATGAAGAGCTGCTAATTGAGGAGGAGGAAGAAGACATGCACACGGCAAGGGTAGAACAACCCTTGCCGCAGCCCCCTAAGCCCTCTAAACCACCCACCACCAGTAAGGACGTCCCAATTTCATGTTATTTTGATGTTATTCCACCCAATGTCCCTTTTCCTAGCAGGTTTTTGATTCCCAACCAAGAAGAGAGTAAAAAGGACATCGTGGAAGCCTTCCCAAAGGTGCAAAATGCTATTCAAATTCTTGGTGCAACACAAAGAATGATTCAAGAGAAGGTAGTGGCTGGAGAAGATGTAGAAGGCATCAAAGACGACATATTTGAAACCACAATTCCCAAGGAAGTTGGATTTTATGACACGGGACAAGTCATAACTTTCGAAGGGGTGTTTATTCTGGAGTTCATTTTGGAGCACACAGGTAAGCCGCGTCCCCGAATTTCAATTTTCTTTTATACTAACATGTGGTTAATGATTCAGGCACCCAATCTGGAATTTAAACTATTACCGGATCATTTCAAGTATCACCGCCCATTCAAAGATAAATTCCATCTTCACAAAGGTTGTTTACGTGAAGCCCCACTACGAGGCCCATCGGAGCGGGAGGCATCGGAGCTAGAGCATTCCAGGCCTCAATACTTGGCCAAGCGCTGGATGAACCAGGAAAAAGGTGCCTCTGGAGATAAGACGCAAGCCTTTGACGGTCACTGTGAATTCGACCCTCAGATTCTTGCAGCTCATCAAGCTTCCTCTTCATCCCCGACGAATAGTTATTTGCAAGCACATGCAAACTTCTATTCTCGTACTTAA

Protein Analysis

286

Amino Acids

32.61

Weight (kDa)

5.42

Isoelectric Point (pI)

53.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 162
Acc36I ACCTGC 1 cut(s) 204
AccB1I GGYRCC 2 cut(s) 529, 719
AccB7I CCANNNNNTGG 1 cut(s) 699
AccBSI CCGCTC 1 cut(s) 649
AccII CGCG 1 cut(s) 478
AciI CCGC 4 cut(s) 116, 476, 577, 649
AclWI GGATC 1 cut(s) 567
AcoI YGGCCR 1 cut(s) 690
AcsI RAATTY 5 cut(s) 291, 486, 542, 593, 761
AcyI GRCGYC 1 cut(s) 159
AfaI GTAC 1 cut(s) 853
AfeI AGCGCT 1 cut(s) 698
AfiI CCNNNNNNNGG 3 cut(s) 46, 635, 699
AflIII ACRYGT 1 cut(s) 510
AgsI TTSAA 6 cut(s) 290, 320, 374, 492, 568, 586
AjnI CCWGG 2 cut(s) 674, 708
AluBI AGCT 5 cut(s) 14, 58, 664, 785, 794
AluI AGCT 5 cut(s) 14, 58, 664, 785, 794
Alw21I GWGCWC 1 cut(s) 465
AlwI GGATC 1 cut(s) 567
Aor51HI AGCGCT 1 cut(s) 698
AoxI GGCC 3 cut(s) 637, 677, 690
ApeKI GCWGC 3 cut(s) 58, 118, 782
ApoI RAATTY 5 cut(s) 291, 486, 542, 593, 761
ArsI GACNNNNNNTTYG 2 cut(s) 353, 385
AspLEI GCGC 1 cut(s) 699
AspS9I GGNCC 1 cut(s) 638
AsuHPI GGTGA 1 cut(s) 566
AsuII TTCGAA 1 cut(s) 429
BalI TGGCCA 1 cut(s) 692
BanI GGYRCC 2 cut(s) 529, 719
BarI GAAGNNNNNNTAC 2 cut(s) 615, 647
BbsI GAAGAC 1 cut(s) 87
Bbv12I GWGCWC 1 cut(s) 465
BbvI GCAGC 3 cut(s) 45, 130, 794
BccI CCATC 2 cut(s) 606, 649
BceAI ACGGC 1 cut(s) 108
BciT130I CCWGG 2 cut(s) 676, 710
BfaI CTAG 3 cut(s) 41, 210, 665
BfoI RGCGCY 1 cut(s) 700
BfuAI ACCTGC 1 cut(s) 204
BisI GCNGC 5 cut(s) 59, 116, 119, 476, 783
BlsI GCNGC 5 cut(s) 60, 117, 120, 477, 784
Bme1390I CCNGG 2 cut(s) 676, 710
BmgT120I GGNCC 1 cut(s) 638
BmiI GGNNCC 2 cut(s) 531, 721
BmrFI CCNGG 2 cut(s) 676, 710
BmsI GCATC 2 cut(s) 363, 665
BpiI GAAGAC 1 cut(s) 87
BpmI CTGGAG 3 cut(s) 357, 467, 747
Bpu10I CCTNAGC 1 cut(s) 126
Bpu14I TTCGAA 1 cut(s) 429
BsaAI YACGTR 1 cut(s) 620
BsaHI GRCGYC 1 cut(s) 159
BsaJI CCNNGG 1 cut(s) 387
BsaWI WCCGGW 1 cut(s) 556
BsaXI ACNNNNNCTCC 2 cut(s) 330, 360
Bsc4I CCNNNNNNNGG 3 cut(s) 46, 635, 699
Bse1I ACTGG 1 cut(s) 150
BseBI CCWGG 2 cut(s) 676, 710
BseDI CCNNGG 1 cut(s) 387
BseGI GGATG 3 cut(s) 55, 708, 803
BseLI CCNNNNNNNGG 3 cut(s) 46, 635, 699
BseMII CTCAG 1 cut(s) 785
BseNI ACTGG 1 cut(s) 150
BseRI GAGGAG 2 cut(s) 83, 86
BseXI GCAGC 3 cut(s) 45, 130, 794
Bsh1236I CGCG 1 cut(s) 478
BshFI GGCC 3 cut(s) 639, 679, 692
BshNI GGYRCC 2 cut(s) 529, 719
BsiHKAI GWGCWC 1 cut(s) 465
BsiSI CCGG 1 cut(s) 557
BslFI GGGAC 4 cut(s) 146, 185, 426, 465
BslI CCNNNNNNNGG 3 cut(s) 46, 635, 699
BsmFI GGGAC 4 cut(s) 146, 185, 426, 465
BsmI GAATGC 1 cut(s) 670
BsnI GGCC 3 cut(s) 639, 679, 692
Bsp119I TTCGAA 1 cut(s) 429
Bsp1286I GDGCHC 1 cut(s) 465
Bsp143I GATC 1 cut(s) 559
BspACI CCGC 4 cut(s) 116, 476, 577, 649
BspANI GGCC 3 cut(s) 639, 679, 692
BspCNI CTCAG 1 cut(s) 784
BspFNI CGCG 1 cut(s) 478
BspLI GGNNCC 2 cut(s) 531, 721
BspMI ACCTGC 1 cut(s) 204
BspPI GGATC 1 cut(s) 567
BspQI GCTCTTC 1 cut(s) 48
BspT104I TTCGAA 1 cut(s) 429
BspT107I GGYRCC 2 cut(s) 529, 719
BsrBI CCGCTC 1 cut(s) 649
BsrI ACTGG 1 cut(s) 150
BssECI CCNNGG 1 cut(s) 387
BssMI GATC 1 cut(s) 559
BssNI GRCGYC 1 cut(s) 159
BssT1I CCWWGG 1 cut(s) 387
Bst2UI CCWGG 2 cut(s) 676, 710
Bst4CI ACNGT 2 cut(s) 752, 758
Bst6I CTCTTC 3 cut(s) 48, 231, 805
BstACI GRCGYC 1 cut(s) 159
BstBAI YACGTR 1 cut(s) 620
BstBI TTCGAA 1 cut(s) 429
BstC8I GCNNGC 2 cut(s) 741, 828
BstDEI CTNAG 2 cut(s) 126, 771
BstF5I GGATG 3 cut(s) 55, 708, 803
BstFNI CGCG 1 cut(s) 478
BstH2I RGCGCY 1 cut(s) 700
BstHHI GCGC 1 cut(s) 699
BstKTI GATC 1 cut(s) 562
BstMBI GATC 1 cut(s) 559
BstMWI GCNNNNNNNGC 3 cut(s) 127, 676, 791
BstNI CCWGG 2 cut(s) 676, 710
BstNSI RCATGY 3 cut(s) 88, 514, 836
BstSCI CCNGG 2 cut(s) 674, 708
BstUI CGCG 1 cut(s) 478
BstV1I GCAGC 3 cut(s) 45, 130, 794
BstV2I GAAGAC 1 cut(s) 87
BsuRI GGCC 3 cut(s) 639, 679, 692
BtsCI GGATG 3 cut(s) 55, 708, 803
BtsIMutI CAGTG 1 cut(s) 754
BveI ACCTGC 1 cut(s) 204
Cac8I GCNNGC 2 cut(s) 741, 828
CfoI GCGC 1 cut(s) 699
Cfr13I GGNCC 1 cut(s) 638
CseI GACGC 2 cut(s) 467, 745
Csp6I GTAC 1 cut(s) 852
CviAII CATG 4 cut(s) 85, 171, 511, 833
CviQI GTAC 1 cut(s) 852
DdeI CTNAG 2 cut(s) 126, 771
DpnI GATC 1 cut(s) 561
DpnII GATC 1 cut(s) 559
DraI TTTAAA 1 cut(s) 547
EaeI YGGCCR 1 cut(s) 690
Eam1104I CTCTTC 3 cut(s) 48, 231, 805
EarI CTCTTC 3 cut(s) 48, 231, 805
Eco130I CCWWGG 1 cut(s) 387
Eco147I AGGCCT 1 cut(s) 679
Eco47III AGCGCT 1 cut(s) 698
EcoRI GAATTC 1 cut(s) 761
EcoRII CCWGG 2 cut(s) 674, 708
EcoT14I CCWWGG 1 cut(s) 387
ErhI CCWWGG 1 cut(s) 387
FaeI CATG 4 cut(s) 88, 174, 514, 836
FaiI YATR 9 cut(s) 36, 86, 172, 368, 405, 422, 504, 512, 834
FaqI GGGAC 4 cut(s) 146, 185, 426, 465
FatI CATG 4 cut(s) 84, 170, 510, 832
FauI CCCGC 1 cut(s) 642
Fnu4HI GCNGC 5 cut(s) 59, 116, 119, 476, 783
FokI GGATG 3 cut(s) 62, 715, 790
Fsp4HI GCNGC 5 cut(s) 59, 116, 119, 476, 783
FspBI CTAG 3 cut(s) 41, 210, 665
GlaI GCGC 1 cut(s) 698
GluI GCNGC 5 cut(s) 59, 116, 119, 476, 783
GsuI CTGGAG 3 cut(s) 357, 467, 747
HaeII RGCGCY 1 cut(s) 700
HaeIII GGCC 3 cut(s) 639, 679, 692
HapII CCGG 1 cut(s) 557
HgaI GACGC 2 cut(s) 467, 745
HhaI GCGC 1 cut(s) 699
Hin1I GRCGYC 1 cut(s) 159
Hin1II CATG 4 cut(s) 88, 174, 514, 836
Hin6I GCGC 1 cut(s) 697
HinP1I GCGC 1 cut(s) 697
HindIII AAGCTT 1 cut(s) 792
HinfI GANTC 4 cut(s) 223, 316, 523, 775
HpaII CCGG 1 cut(s) 557
HphI GGTGA 1 cut(s) 566
Hpy166II GTNNAC 1 cut(s) 617
Hpy188I TCNGA 3 cut(s) 646, 661, 774
Hpy188III TCNNGA 4 cut(s) 320, 446, 539, 726
Hpy8I GTNNAC 1 cut(s) 617
Hpy99I CGWCG 1 cut(s) 814
HpyAV CCTTC 4 cut(s) 274, 319, 344, 425
HpyCH4III ACNGT 2 cut(s) 752, 758
HpyCH4IV ACGT 2 cut(s) 159, 619
HpyCH4V TGCA 6 cut(s) 88, 277, 302, 782, 826, 836
HpyF10VI GCNNNNNNNGC 3 cut(s) 127, 676, 791
HpyF3I CTNAG 2 cut(s) 126, 771
HpySE526I ACGT 2 cut(s) 159, 619
Hsp92I GRCGYC 1 cut(s) 159
Hsp92II CATG 4 cut(s) 88, 174, 514, 836
HspAI GCGC 1 cut(s) 697
Kzo9I GATC 1 cut(s) 559
LguI GCTCTTC 1 cut(s) 48
LmnI GCTCC 4 cut(s) 11, 460, 646, 661
Lsp1109I GCAGC 3 cut(s) 45, 130, 794
LweI GCATC 2 cut(s) 363, 665
MaeI CTAG 3 cut(s) 41, 210, 665
MaeII ACGT 2 cut(s) 159, 619
MaeIII GTNAC 1 cut(s) 752
MalI GATC 1 cut(s) 561
MbiI CCGCTC 1 cut(s) 649
MboI GATC 1 cut(s) 559
MboII GAAGA 7 cut(s) 65, 89, 92, 248, 353, 593, 792
MhlI GDGCHC 1 cut(s) 465
MlsI TGGCCA 1 cut(s) 692
MluCI AATT 9 cut(s) 63, 165, 291, 381, 486, 492, 542, 593, 761
MluNI TGGCCA 1 cut(s) 692
MmeI TCCRAC 1 cut(s) 376
Mox20I TGGCCA 1 cut(s) 692
MscI TGGCCA 1 cut(s) 692
MseI TTAA 3 cut(s) 518, 546, 856
Msp20I TGGCCA 1 cut(s) 692
MspI CCGG 1 cut(s) 557
MspR9I CCNGG 2 cut(s) 676, 710
Mva1269I GAATGC 1 cut(s) 670
MvaI CCWGG 2 cut(s) 676, 710
MvnI CGCG 1 cut(s) 478
MwoI GCNNNNNNNGC 3 cut(s) 127, 676, 791
NdeII GATC 1 cut(s) 559
NlaIII CATG 4 cut(s) 88, 174, 514, 836
NlaIV GGNNCC 2 cut(s) 531, 721
NmuCI GTSAC 1 cut(s) 752
NspI RCATGY 3 cut(s) 88, 514, 836
NspV TTCGAA 1 cut(s) 429
PceI AGGCCT 1 cut(s) 679
PciI ACATGT 1 cut(s) 510
PciSI GCTCTTC 1 cut(s) 48
PctI GAATGC 1 cut(s) 670
PfeI GAWTC 4 cut(s) 223, 316, 523, 775
PflMI CCANNNNNTGG 1 cut(s) 699
PkrI GCNGC 5 cut(s) 60, 117, 120, 477, 784
Ppu21I YACGTR 1 cut(s) 620
PscI ACATGT 1 cut(s) 510
Psp6I CCWGG 2 cut(s) 674, 708
PspGI CCWGG 2 cut(s) 674, 708
PspN4I GGNNCC 2 cut(s) 531, 721
PspPI GGNCC 1 cut(s) 638
RsaI GTAC 1 cut(s) 853
RsaNI GTAC 1 cut(s) 852
SapI GCTCTTC 1 cut(s) 48
SaqAI TTAA 3 cut(s) 518, 546, 856
SatI GCNGC 5 cut(s) 59, 116, 119, 476, 783
Sau3AI GATC 1 cut(s) 559
Sau96I GGNCC 1 cut(s) 638
ScrFI CCNGG 2 cut(s) 676, 710
SduI GDGCHC 1 cut(s) 465
SfaNI GCATC 2 cut(s) 363, 665
SfuI TTCGAA 1 cut(s) 429
Sse9I AATT 9 cut(s) 63, 165, 291, 381, 486, 492, 542, 593, 761
SseBI AGGCCT 1 cut(s) 679
SsiI CCGC 4 cut(s) 116, 476, 577, 649
SspMI CTAG 3 cut(s) 41, 210, 665
StuI AGGCCT 1 cut(s) 679
StyD4I CCNGG 2 cut(s) 674, 708
StyI CCWWGG 1 cut(s) 387
TaaI ACNGT 2 cut(s) 752, 758
TaiI ACGT 2 cut(s) 162, 622
TaqI TCGA 2 cut(s) 429, 765
TasI AATT 9 cut(s) 63, 165, 291, 381, 486, 492, 542, 593, 761
TauI GCSGC 2 cut(s) 118, 478
TfiI GAWTC 4 cut(s) 223, 316, 523, 775
Tru1I TTAA 3 cut(s) 518, 546, 856
Tru9I TTAA 3 cut(s) 518, 546, 856
TscAI CASTG 1 cut(s) 761
TseFI GTSAC 1 cut(s) 752
TseI GCWGC 3 cut(s) 58, 118, 782
Tsp45I GTSAC 1 cut(s) 752
TspDTI ATGAA 5 cut(s) 66, 159, 442, 719, 792
TspRI CASTG 1 cut(s) 761
Van91I CCANNNNNTGG 1 cut(s) 699
XapI RAATTY 5 cut(s) 291, 486, 542, 593, 761
XceI RCATGY 3 cut(s) 88, 514, 836
XspI CTAG 3 cut(s) 41, 210, 665
ZraI GACGTC 1 cut(s) 160
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.