pycom12681g00050

Chloroplast-localized elongation factor EF-G involved in protein synthesis in plastids. Catalyzes the GTP-dependent ribosomal translocation step during translation elongation. During this step, the ribosome changes from the pre-translocational (PRE) to the post-translocational (POST) state as the newly formed A- site-bound peptidyl-tRNA and P-site-bound deacylated tRNA move to the P and E sites, respectively. Catalyzes the coordinated movement of the two tRNA molecules, the mRNA and conformational changes in the ribosome

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00012681
Physical Location & Seq
Forward (+)
51753 .. 60519
8767 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 915 bp
ATGAAACAAATTCAAGAGCAAAGTGAACTCCCCAACTCAACTATTGAAAACTCGAAGGAAGATTTTGAAATCCATAATGTTATCACTTTGGGAAGTGCTATAGAGGTTGGAGCGGACCTAAAAATGTCCAAACATAGCCTAGAAGTGGATGAGGAGCTGCTAATTGAGGAGGAGGAAGAAGACATGCAAACGGCAAGGGTAGAACAACCCTTGCCGCAGCCCCCTAAGCCCTCTAAACCACCCACCACAAGTAAGGACGTCCCAATTCCATGTTATTCTGATGTTATTCCACCCAATGTCCCTTTTCCTAGCAGGTTTTTGATTCCCAACCAAGAAGAGAGTAAAAAGGACATCGTGGAAGCCTTCCCAAAGGTGCAAAATGCTATTCCAATTCTTGGTGCAACACAAAGAATGATTCAAGAGAAGGTAGTGGCTGGAGAAGATGTAGAAGGCATCAAAGAGGACATAATTGAAACCACAATTCCCAAGGAAGTTGGATTTTATGACACGGGACAAGTCATAACTTTCGAAGGGGTGTTTATTATGGAGTTCATTTTGGAGCACACAGGTAAGCCGCCTCCCCGAATTTCAATTTTCTTTTATACTAACATGTGGTTAATGATTCAGGCACCCAATCTGGAATTTAAACTATTACCGGATCATTTCAAGTATCACCGCCCATTCAAAGATAAATTCCATGCCGTGGAGCTTCACAAAGGTTGTTTGCGTGAAGCCCCACTACGAGGCGCAGAAGCGGAAGGCGCAGAAGCGGGAGGCGCAGAAGCGGAAGGCGCAGAAGCGGGAGGCATAGAAGCGGGAGGCATCGGAGCGGGAGGCATCGGAGCTAGAGCATTCCAGGCCTCAATACTTGGCCAAGCGCTGGATGACCCAGGAAAAAGGTGCCTCTGGAGATAA

Protein Analysis

305

Amino Acids

33.57

Weight (kDa)

4.76

Isoelectric Point (pI)

49.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 261
Acc36I ACCTGC 1 cut(s) 303
AccB1I GGYRCC 2 cut(s) 628, 900
AccB7I CCANNNNNTGG 3 cut(s) 395, 703, 880
AccBSI CCGCTC 2 cut(s) 113, 830
AclWI GGATC 1 cut(s) 666
AcoI YGGCCR 1 cut(s) 871
AcsI RAATTY 4 cut(s) 9, 585, 641, 692
AcyI GRCGYC 1 cut(s) 258
AfeI AGCGCT 1 cut(s) 879
AfiI CCNNNNNNNGG 5 cut(s) 145, 395, 703, 743, 880
AflIII ACRYGT 1 cut(s) 609
AgsI TTSAA 8 cut(s) 14, 47, 68, 419, 473, 591, 667, 685
AjnI CCWGG 2 cut(s) 855, 889
AluBI AGCT 3 cut(s) 157, 709, 845
AluI AGCT 3 cut(s) 157, 709, 845
Alw21I GWGCWC 1 cut(s) 564
AlwI GGATC 1 cut(s) 666
Aor51HI AGCGCT 1 cut(s) 879
AoxI GGCC 2 cut(s) 858, 871
ApeKI GCWGC 2 cut(s) 157, 217
ApoI RAATTY 4 cut(s) 9, 585, 641, 692
AspLEI GCGC 5 cut(s) 749, 764, 779, 794, 880
AspS9I GGNCC 1 cut(s) 115
AsuHPI GGTGA 1 cut(s) 665
AsuII TTCGAA 1 cut(s) 528
AvaII GGWCC 1 cut(s) 115
BalI TGGCCA 1 cut(s) 873
BanI GGYRCC 2 cut(s) 628, 900
BarI GAAGNNNNNNTAC 2 cut(s) 723, 755
BbsI GAAGAC 1 cut(s) 186
Bbv12I GWGCWC 1 cut(s) 564
BbvI GCAGC 2 cut(s) 144, 229
BceAI ACGGC 2 cut(s) 207, 686
BciT130I CCWGG 2 cut(s) 857, 891
BfaI CTAG 3 cut(s) 140, 309, 846
BfmI CTRYAG 1 cut(s) 99
BfoI RGCGCY 1 cut(s) 881
BfuAI ACCTGC 1 cut(s) 303
BisI GCNGC 4 cut(s) 158, 215, 218, 575
BlsI GCNGC 4 cut(s) 159, 216, 219, 576
Bme1390I CCNGG 2 cut(s) 857, 891
Bme18I GGWCC 1 cut(s) 115
BmgT120I GGNCC 1 cut(s) 115
BmiI GGNNCC 2 cut(s) 630, 902
BmrFI CCNGG 2 cut(s) 857, 891
BmsI GCATC 3 cut(s) 462, 831, 846
BpiI GAAGAC 1 cut(s) 186
BpmI CTGGAG 1 cut(s) 456
Bpu10I CCTNAGC 1 cut(s) 225
Bpu14I TTCGAA 1 cut(s) 528
BsaHI GRCGYC 1 cut(s) 258
BsaJI CCNNGG 3 cut(s) 486, 702, 889
BsaWI WCCGGW 1 cut(s) 655
BsaXI ACNNNNNCTCC 2 cut(s) 429, 459
Bsc4I CCNNNNNNNGG 5 cut(s) 145, 395, 703, 743, 880
BseBI CCWGG 2 cut(s) 857, 891
BseDI CCNNGG 3 cut(s) 486, 702, 889
BseGI GGATG 2 cut(s) 154, 889
BseLI CCNNNNNNNGG 5 cut(s) 145, 395, 703, 743, 880
BseRI GAGGAG 3 cut(s) 167, 182, 185
BseXI GCAGC 2 cut(s) 144, 229
BshFI GGCC 2 cut(s) 860, 873
BshNI GGYRCC 2 cut(s) 628, 900
BsiHKAI GWGCWC 1 cut(s) 564
BsiSI CCGG 1 cut(s) 656
BslFI GGGAC 3 cut(s) 245, 284, 525
BslI CCNNNNNNNGG 5 cut(s) 145, 395, 703, 743, 880
BsmFI GGGAC 3 cut(s) 245, 284, 525
BsmI GAATGC 1 cut(s) 851
BsnI GGCC 2 cut(s) 860, 873
Bsp119I TTCGAA 1 cut(s) 528
Bsp1286I GDGCHC 1 cut(s) 564
Bsp143I GATC 1 cut(s) 658
BspANI GGCC 2 cut(s) 860, 873
BspLI GGNNCC 2 cut(s) 630, 902
BspMI ACCTGC 1 cut(s) 303
BspPI GGATC 1 cut(s) 666
BspT104I TTCGAA 1 cut(s) 528
BspT107I GGYRCC 2 cut(s) 628, 900
BsrBI CCGCTC 2 cut(s) 113, 830
BssECI CCNNGG 3 cut(s) 486, 702, 889
BssMI GATC 1 cut(s) 658
BssNI GRCGYC 1 cut(s) 258
BssT1I CCWWGG 1 cut(s) 486
Bst2UI CCWGG 2 cut(s) 857, 891
Bst6I CTCTTC 1 cut(s) 330
BstACI GRCGYC 1 cut(s) 258
BstBI TTCGAA 1 cut(s) 528
BstDEI CTNAG 1 cut(s) 225
BstDSI CCRYGG 1 cut(s) 702
BstF5I GGATG 2 cut(s) 154, 889
BstH2I RGCGCY 1 cut(s) 881
BstHHI GCGC 5 cut(s) 749, 764, 779, 794, 880
BstKTI GATC 1 cut(s) 661
BstMBI GATC 1 cut(s) 658
BstMWI GCNNNNNNNGC 5 cut(s) 226, 761, 776, 791, 857
BstNI CCWGG 2 cut(s) 857, 891
BstNSI RCATGY 2 cut(s) 187, 613
BstSCI CCNGG 2 cut(s) 855, 889
BstSFI CTRYAG 1 cut(s) 99
BstV1I GCAGC 2 cut(s) 144, 229
BstV2I GAAGAC 1 cut(s) 186
BsuRI GGCC 2 cut(s) 860, 873
BtgI CCRYGG 1 cut(s) 702
BtsCI GGATG 2 cut(s) 154, 889
BveI ACCTGC 1 cut(s) 303
CfoI GCGC 5 cut(s) 749, 764, 779, 794, 880
Cfr13I GGNCC 1 cut(s) 115
CviAII CATG 4 cut(s) 184, 270, 610, 698
DdeI CTNAG 1 cut(s) 225
DpnI GATC 1 cut(s) 660
DpnII GATC 1 cut(s) 658
DraI TTTAAA 1 cut(s) 646
EaeI YGGCCR 1 cut(s) 871
Eam1104I CTCTTC 1 cut(s) 330
EarI CTCTTC 1 cut(s) 330
Eco130I CCWWGG 1 cut(s) 486
Eco147I AGGCCT 1 cut(s) 860
Eco47I GGWCC 1 cut(s) 115
Eco47III AGCGCT 1 cut(s) 879
EcoRII CCWGG 2 cut(s) 855, 889
EcoT14I CCWWGG 1 cut(s) 486
ErhI CCWWGG 1 cut(s) 486
FaeI CATG 4 cut(s) 187, 273, 613, 701
FaqI GGGAC 3 cut(s) 245, 284, 525
FatI CATG 4 cut(s) 183, 269, 609, 697
FauI CCCGC 4 cut(s) 763, 793, 808, 823
Fnu4HI GCNGC 4 cut(s) 158, 215, 218, 575
FokI GGATG 2 cut(s) 161, 896
Fsp4HI GCNGC 4 cut(s) 158, 215, 218, 575
FspBI CTAG 3 cut(s) 140, 309, 846
GlaI GCGC 5 cut(s) 748, 763, 778, 793, 879
GluI GCNGC 4 cut(s) 158, 215, 218, 575
GsuI CTGGAG 1 cut(s) 456
HaeII RGCGCY 1 cut(s) 881
HaeIII GGCC 2 cut(s) 860, 873
HapII CCGG 1 cut(s) 656
HhaI GCGC 5 cut(s) 749, 764, 779, 794, 880
Hin1I GRCGYC 1 cut(s) 258
Hin1II CATG 4 cut(s) 187, 273, 613, 701
Hin6I GCGC 5 cut(s) 747, 762, 777, 792, 878
HinP1I GCGC 5 cut(s) 747, 762, 777, 792, 878
HinfI GANTC 3 cut(s) 322, 415, 622
HpaII CCGG 1 cut(s) 656
HphI GGTGA 1 cut(s) 665
Hpy166II GTNNAC 1 cut(s) 26
Hpy188I TCNGA 3 cut(s) 280, 827, 842
Hpy188III TCNNGA 4 cut(s) 14, 419, 638, 907
Hpy8I GTNNAC 1 cut(s) 26
HpyAV CCTTC 7 cut(s) 49, 373, 418, 443, 524, 752, 782
HpyCH4IV ACGT 1 cut(s) 258
HpyCH4V TGCA 3 cut(s) 187, 376, 401
HpyF10VI GCNNNNNNNGC 5 cut(s) 226, 761, 776, 791, 857
HpyF3I CTNAG 1 cut(s) 225
HpySE526I ACGT 1 cut(s) 258
Hsp92I GRCGYC 1 cut(s) 258
Hsp92II CATG 4 cut(s) 187, 273, 613, 701
HspAI GCGC 5 cut(s) 747, 762, 777, 792, 878
Kzo9I GATC 1 cut(s) 658
LmnI GCTCC 6 cut(s) 110, 154, 559, 706, 827, 842
Lsp1109I GCAGC 2 cut(s) 144, 229
LweI GCATC 3 cut(s) 462, 831, 846
MaeI CTAG 3 cut(s) 140, 309, 846
MaeII ACGT 1 cut(s) 258
MalI GATC 1 cut(s) 660
MbiI CCGCTC 2 cut(s) 113, 830
MboI GATC 1 cut(s) 658
MboII GAAGA 5 cut(s) 71, 188, 191, 347, 452
MhlI GDGCHC 1 cut(s) 564
MlsI TGGCCA 1 cut(s) 873
MluNI TGGCCA 1 cut(s) 873
MmeI TCCRAC 2 cut(s) 88, 475
Mox20I TGGCCA 1 cut(s) 873
MscI TGGCCA 1 cut(s) 873
MseI TTAA 2 cut(s) 617, 645
Msp20I TGGCCA 1 cut(s) 873
MspI CCGG 1 cut(s) 656
MspR9I CCNGG 2 cut(s) 857, 891
Mva1269I GAATGC 1 cut(s) 851
MvaI CCWGG 2 cut(s) 857, 891
MwoI GCNNNNNNNGC 5 cut(s) 226, 761, 776, 791, 857
NdeII GATC 1 cut(s) 658
NlaIII CATG 4 cut(s) 187, 273, 613, 701
NlaIV GGNNCC 2 cut(s) 630, 902
NspI RCATGY 2 cut(s) 187, 613
NspV TTCGAA 1 cut(s) 528
PceI AGGCCT 1 cut(s) 860
PciI ACATGT 1 cut(s) 609
PctI GAATGC 1 cut(s) 851
PfeI GAWTC 3 cut(s) 322, 415, 622
PflMI CCANNNNNTGG 3 cut(s) 395, 703, 880
PkrI GCNGC 4 cut(s) 159, 216, 219, 576
PscI ACATGT 1 cut(s) 609
Psp6I CCWGG 2 cut(s) 855, 889
PspGI CCWGG 2 cut(s) 855, 889
PspN4I GGNNCC 2 cut(s) 630, 902
PspPI GGNCC 1 cut(s) 115
SaqAI TTAA 2 cut(s) 617, 645
SatI GCNGC 4 cut(s) 158, 215, 218, 575
Sau3AI GATC 1 cut(s) 658
Sau96I GGNCC 1 cut(s) 115
ScrFI CCNGG 2 cut(s) 857, 891
SduI GDGCHC 1 cut(s) 564
SfaNI GCATC 3 cut(s) 462, 831, 846
SfcI CTRYAG 1 cut(s) 99
SfuI TTCGAA 1 cut(s) 528
SinI GGWCC 1 cut(s) 115
SseBI AGGCCT 1 cut(s) 860
SspMI CTAG 3 cut(s) 140, 309, 846
StuI AGGCCT 1 cut(s) 860
StyD4I CCNGG 2 cut(s) 855, 889
StyI CCWWGG 1 cut(s) 486
TaiI ACGT 1 cut(s) 261
TaqI TCGA 2 cut(s) 53, 528
TauI GCSGC 2 cut(s) 217, 577
TfiI GAWTC 3 cut(s) 322, 415, 622
Tru1I TTAA 2 cut(s) 617, 645
Tru9I TTAA 2 cut(s) 617, 645
TseI GCWGC 2 cut(s) 157, 217
TspDTI ATGAA 2 cut(s) 17, 541
Van91I CCANNNNNTGG 3 cut(s) 395, 703, 880
VpaK11BI GGWCC 1 cut(s) 115
XapI RAATTY 4 cut(s) 9, 585, 641, 692
XceI RCATGY 2 cut(s) 187, 613
XspI CTAG 3 cut(s) 140, 309, 846
ZraI GACGTC 1 cut(s) 259
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.