pycom12681g00060

Nudix hydrolase 3-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00012681
Physical Location & Seq
Reverse (-)
82725 .. 84695
1971 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 714 bp
ATGGCAAACTCATCGAACCTTAGCTTGGAATTGAGCCTTAGCAGTGATACGGGCGCGCCGCGTCAAGGTAACGTATGGCGCCCTTCTTTCTTATCTTCTAACGGTCTTCTTACAGGTGAAGACTCTGTGATGCAGGACGCCACAACAGCTACAATAGTAGCTAGGAACCTCCTCACTCCAAAAGATAGTAGGCTGCTGTCAGGACGGTCCGATGAGTTGGCCGTTCAAGAGTCCCTCGCACTTAGTGTTCAGTGTGCGAGTTCTGTGTCCAACATGGGCCAACGCCTGCTTGCCCGCTCCCGTCAGGTGGAATCATTGATGGCAGAGGTGGAAAGTCTTAAGCAAGAGATCCAGCAGCTTAAGTACGAGAATAGAAGTTTGCACGTGCTTGCCAACAACTATTCGACGGGCATGAAGAGGAAGCTTGATGAGCTGCAAGAGTCTGAAGGTCGGATTCACAGTGACCGTCAAAGGTTTTCGTCTTTCCTCCAGAGGCACCTTTTTCCTGGCTCATCCAGCGCTTGGCCAAGTATTGAGGCCTGGAATGCTCTAGCTCCGATGCCTCCCACTCCGATGCCTTCCACTCCGATGCCTTCCGCTTCGATGCCTTCCGCTCCGATGCCTTCTGCTTCAAAGCCTTCTGCTTCTATGCCTTCCGCTACTATTAAAGGGGGATTTAACATAAACATATATTTCGAATCACCCCCTAGCTAA

Protein Analysis

238

Amino Acids

25.7

Weight (kDa)

6.85

Isoelectric Point (pI)

69.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 78, 495
AccB7I CCANNNNNTGG 1 cut(s) 522
AccBSI CCGCTC 2 cut(s) 297, 614
AccII CGCG 2 cut(s) 56, 61
AciI CCGC 5 cut(s) 59, 295, 597, 612, 657
AclWI GGATC 1 cut(s) 343
AcoI YGGCCR 2 cut(s) 219, 524
AcuI CTGAAG 1 cut(s) 465
AcvI CACGTG 1 cut(s) 385
AcyI GRCGYC 2 cut(s) 79, 138
AdeI CACNNNGTG 1 cut(s) 245
AfaI GTAC 1 cut(s) 365
AfeI AGCGCT 1 cut(s) 520
AfiI CCNNNNNNNGG 4 cut(s) 25, 65, 307, 522
AflII CTTAAG 2 cut(s) 338, 359
AgsI TTSAA 2 cut(s) 227, 633
AjnI CCWGG 2 cut(s) 505, 539
AjuI GAANNNNNNNTTGG 2 cut(s) 8, 40
AluBI AGCT 8 cut(s) 24, 149, 161, 358, 424, 433, 554, 711
AluI AGCT 8 cut(s) 24, 149, 161, 358, 424, 433, 554, 711
AlwI GGATC 1 cut(s) 343
Aor51HI AGCGCT 1 cut(s) 520
AoxI GGCC 4 cut(s) 219, 277, 524, 537
ApeKI GCWGC 3 cut(s) 193, 355, 433
AscI GGCGCGCC 1 cut(s) 54
AspLEI GCGC 4 cut(s) 56, 58, 81, 521
AspS9I GGNCC 2 cut(s) 207, 277
AsuHPI GGTGA 2 cut(s) 128, 693
AsuII TTCGAA 1 cut(s) 696
AvaII GGWCC 1 cut(s) 207
BalI TGGCCA 1 cut(s) 526
BanI GGYRCC 2 cut(s) 78, 495
BbrPI CACGTG 1 cut(s) 385
BbsI GAAGAC 2 cut(s) 98, 126
BbvI GCAGC 3 cut(s) 180, 367, 420
BccI CCATC 1 cut(s) 313
BceAI ACGGC 1 cut(s) 206
BcgI CGANNNNNNTGC 1 cut(s) 28
BciT130I CCWGG 2 cut(s) 507, 541
BfaI CTAG 3 cut(s) 162, 551, 708
BfoI RGCGCY 2 cut(s) 82, 522
BfrI CTTAAG 2 cut(s) 338, 359
BisI GCNGC 4 cut(s) 59, 194, 356, 434
BlsI GCNGC 4 cut(s) 60, 195, 357, 435
Bme1390I CCNGG 2 cut(s) 507, 541
Bme18I GGWCC 1 cut(s) 207
BmgT120I GGNCC 2 cut(s) 207, 277
BmiI GGNNCC 3 cut(s) 80, 167, 497
BmrFI CCNGG 2 cut(s) 507, 541
BmsI GCATC 6 cut(s) 120, 549, 564, 579, 594, 609
BpiI GAAGAC 2 cut(s) 98, 126
BpmI CTGGAG 1 cut(s) 473
Bpu10I CCTNAGC 2 cut(s) 20, 38
Bpu14I TTCGAA 1 cut(s) 696
BsaAI YACGTR 1 cut(s) 385
BsaHI GRCGYC 2 cut(s) 79, 138
Bsc4I CCNNNNNNNGG 4 cut(s) 25, 65, 307, 522
BseBI CCWGG 2 cut(s) 507, 541
BseGI GGATG 1 cut(s) 512
BseLI CCNNNNNNNGG 4 cut(s) 25, 65, 307, 522
BsePI GCGCGC 1 cut(s) 54
BseRI GAGGAG 1 cut(s) 161
BseXI GCAGC 3 cut(s) 180, 367, 420
Bsh1236I CGCG 2 cut(s) 56, 61
BshFI GGCC 4 cut(s) 221, 279, 526, 539
BshNI GGYRCC 2 cut(s) 78, 495
BslFI GGGAC 1 cut(s) 217
BslI CCNNNNNNNGG 4 cut(s) 25, 65, 307, 522
BsmFI GGGAC 1 cut(s) 217
BsmI GAATGC 1 cut(s) 550
BsnI GGCC 4 cut(s) 221, 279, 526, 539
Bsp119I TTCGAA 1 cut(s) 696
Bsp143I GATC 1 cut(s) 348
BspACI CCGC 5 cut(s) 59, 295, 597, 612, 657
BspANI GGCC 4 cut(s) 221, 279, 526, 539
BspFNI CGCG 2 cut(s) 56, 61
BspLI GGNNCC 3 cut(s) 80, 167, 497
BspPI GGATC 1 cut(s) 343
BspT104I TTCGAA 1 cut(s) 696
BspT107I GGYRCC 2 cut(s) 78, 495
BspTI CTTAAG 2 cut(s) 338, 359
BsrBI CCGCTC 2 cut(s) 297, 614
BssHII GCGCGC 1 cut(s) 54
BssMI GATC 1 cut(s) 348
BssNI GRCGYC 2 cut(s) 79, 138
Bst2UI CCWGG 2 cut(s) 507, 541
Bst4CI ACNGT 4 cut(s) 104, 207, 461, 467
Bst6I CTCTTC 1 cut(s) 410
BstACI GRCGYC 2 cut(s) 79, 138
BstAFI CTTAAG 2 cut(s) 338, 359
BstBAI YACGTR 1 cut(s) 385
BstBI TTCGAA 1 cut(s) 696
BstC8I GCNNGC 5 cut(s) 56, 287, 291, 295, 390
BstDEI CTNAG 3 cut(s) 20, 38, 242
BstF5I GGATG 1 cut(s) 512
BstFNI CGCG 2 cut(s) 56, 61
BstH2I RGCGCY 2 cut(s) 82, 522
BstHHI GCGC 4 cut(s) 56, 58, 81, 521
BstKTI GATC 1 cut(s) 351
BstMBI GATC 1 cut(s) 348
BstMWI GCNNNNNNNGC 4 cut(s) 146, 430, 516, 545
BstNI CCWGG 2 cut(s) 507, 541
BstSCI CCNGG 2 cut(s) 505, 539
BstUI CGCG 2 cut(s) 56, 61
BstV1I GCAGC 3 cut(s) 180, 367, 420
BstV2I GAAGAC 2 cut(s) 98, 126
BstX2I RGATCY 1 cut(s) 348
BstYI RGATCY 1 cut(s) 348
BsuRI GGCC 4 cut(s) 221, 279, 526, 539
BtsCI GGATG 1 cut(s) 512
BtsI GCAGTG 1 cut(s) 49
BtsIMutI CAGTG 3 cut(s) 49, 257, 466
Cac8I GCNNGC 5 cut(s) 56, 287, 291, 295, 390
CfoI GCGC 4 cut(s) 56, 58, 81, 521
Cfr13I GGNCC 2 cut(s) 207, 277
CpoI CGGWCCG 1 cut(s) 207
CseI GACGC 2 cut(s) 50, 146
Csp6I GTAC 1 cut(s) 364
CspI CGGWCCG 1 cut(s) 207
CviAII CATG 2 cut(s) 274, 412
CviQI GTAC 1 cut(s) 364
DdeI CTNAG 3 cut(s) 20, 38, 242
DinI GGCGCC 1 cut(s) 80
DpnI GATC 1 cut(s) 350
DpnII GATC 1 cut(s) 348
DraIII CACNNNGTG 1 cut(s) 245
EaeI YGGCCR 2 cut(s) 219, 524
Eam1104I CTCTTC 1 cut(s) 410
EarI CTCTTC 1 cut(s) 410
Eco147I AGGCCT 1 cut(s) 539
Eco47I GGWCC 1 cut(s) 207
Eco47III AGCGCT 1 cut(s) 520
Eco57I CTGAAG 1 cut(s) 465
Eco72I CACGTG 1 cut(s) 385
EcoRII CCWGG 2 cut(s) 505, 539
EgeI GGCGCC 1 cut(s) 80
EheI GGCGCC 1 cut(s) 80
FaeI CATG 2 cut(s) 277, 415
FaiI YATR 7 cut(s) 76, 275, 413, 650, 683, 689, 691
FaqI GGGAC 1 cut(s) 217
FatI CATG 2 cut(s) 273, 411
FauI CCCGC 1 cut(s) 302
Fnu4HI GCNGC 4 cut(s) 59, 194, 356, 434
FokI GGATG 1 cut(s) 499
Fsp4HI GCNGC 4 cut(s) 59, 194, 356, 434
FspBI CTAG 3 cut(s) 162, 551, 708
GlaI GCGC 4 cut(s) 55, 57, 80, 520
GluI GCNGC 4 cut(s) 59, 194, 356, 434
GsuI CTGGAG 1 cut(s) 473
HaeII RGCGCY 2 cut(s) 82, 522
HaeIII GGCC 4 cut(s) 221, 279, 526, 539
HgaI GACGC 2 cut(s) 50, 146
HhaI GCGC 4 cut(s) 56, 58, 81, 521
Hin1I GRCGYC 2 cut(s) 79, 138
Hin1II CATG 2 cut(s) 277, 415
Hin6I GCGC 4 cut(s) 54, 56, 79, 519
HinP1I GCGC 4 cut(s) 54, 56, 79, 519
HindIII AAGCTT 1 cut(s) 422
HinfI GANTC 6 cut(s) 122, 230, 311, 440, 454, 698
HphI GGTGA 2 cut(s) 128, 693
Hpy188I TCNGA 7 cut(s) 211, 445, 453, 558, 573, 588, 618
Hpy188III TCNNGA 3 cut(s) 201, 227, 490
Hpy99I CGWCG 1 cut(s) 409
HpyAV CCTTC 8 cut(s) 93, 440, 588, 603, 618, 633, 648, 663
HpyCH4III ACNGT 4 cut(s) 104, 207, 461, 467
HpyCH4IV ACGT 2 cut(s) 72, 384
HpyCH4V TGCA 3 cut(s) 133, 382, 436
HpyF10VI GCNNNNNNNGC 4 cut(s) 146, 430, 516, 545
HpyF3I CTNAG 3 cut(s) 20, 38, 242
HpySE526I ACGT 2 cut(s) 72, 384
Hsp92I GRCGYC 2 cut(s) 79, 138
Hsp92II CATG 2 cut(s) 277, 415
HspAI GCGC 4 cut(s) 54, 56, 79, 519
KasI GGCGCC 1 cut(s) 78
Kzo9I GATC 1 cut(s) 348
LmnI GCTCC 3 cut(s) 302, 559, 619
Lsp1109I GCAGC 3 cut(s) 180, 367, 420
LweI GCATC 6 cut(s) 120, 549, 564, 579, 594, 609
MaeI CTAG 3 cut(s) 162, 551, 708
MaeII ACGT 2 cut(s) 72, 384
MaeIII GTNAC 2 cut(s) 68, 461
MalI GATC 1 cut(s) 350
MbiI CCGCTC 2 cut(s) 297, 614
MboI GATC 1 cut(s) 348
MboII GAAGA 4 cut(s) 87, 98, 131, 427
MflI RGATCY 1 cut(s) 348
MlsI TGGCCA 1 cut(s) 526
MluCI AATT 1 cut(s) 29
MluNI TGGCCA 1 cut(s) 526
Mly113I GGCGCC 1 cut(s) 79
MlyI GAGTC 3 cut(s) 116, 239, 449
MmeI TCCRAC 2 cut(s) 294, 431
MnlI CCTC 9 cut(s) 179, 182, 245, 319, 411, 486, 497, 529, 573
Mox20I TGGCCA 1 cut(s) 526
MscI TGGCCA 1 cut(s) 526
MseI TTAA 4 cut(s) 339, 360, 666, 678
MslI CAYNNNNRTG 2 cut(s) 572, 587
Msp20I TGGCCA 1 cut(s) 526
MspCI CTTAAG 2 cut(s) 338, 359
MspR9I CCNGG 2 cut(s) 507, 541
Mva1269I GAATGC 1 cut(s) 550
MvaI CCWGG 2 cut(s) 507, 541
MvnI CGCG 2 cut(s) 56, 61
MwoI GCNNNNNNNGC 4 cut(s) 146, 430, 516, 545
NarI GGCGCC 1 cut(s) 79
NdeII GATC 1 cut(s) 348
NlaIII CATG 2 cut(s) 277, 415
NlaIV GGNNCC 3 cut(s) 80, 167, 497
NmuCI GTSAC 1 cut(s) 461
NspV TTCGAA 1 cut(s) 696
PalAI GGCGCGCC 1 cut(s) 54
PauI GCGCGC 1 cut(s) 54
PceI AGGCCT 1 cut(s) 539
PctI GAATGC 1 cut(s) 550
PfeI GAWTC 3 cut(s) 311, 454, 698
PflMI CCANNNNNTGG 1 cut(s) 522
PkrI GCNGC 4 cut(s) 60, 195, 357, 435
PleI GAGTC 3 cut(s) 116, 238, 448
PluTI GGCGCC 1 cut(s) 82
PmaCI CACGTG 1 cut(s) 385
PmlI CACGTG 1 cut(s) 385
PpsI GAGTC 3 cut(s) 116, 238, 448
Ppu21I YACGTR 1 cut(s) 385
Psp6I CCWGG 2 cut(s) 505, 539
PspCI CACGTG 1 cut(s) 385
PspGI CCWGG 2 cut(s) 505, 539
PspN4I GGNNCC 3 cut(s) 80, 167, 497
PspPI GGNCC 2 cut(s) 207, 277
PsuI RGATCY 1 cut(s) 348
PteI GCGCGC 1 cut(s) 54
RsaI GTAC 1 cut(s) 365
RsaNI GTAC 1 cut(s) 364
RseI CAYNNNNRTG 2 cut(s) 572, 587
Rsr2I CGGWCCG 1 cut(s) 207
RsrII CGGWCCG 1 cut(s) 207
SaqAI TTAA 4 cut(s) 339, 360, 666, 678
SatI GCNGC 4 cut(s) 59, 194, 356, 434
Sau3AI GATC 1 cut(s) 348
Sau96I GGNCC 2 cut(s) 207, 277
SchI GAGTC 3 cut(s) 116, 239, 449
ScrFI CCNGG 2 cut(s) 507, 541
SfaNI GCATC 6 cut(s) 120, 549, 564, 579, 594, 609
SfoI GGCGCC 1 cut(s) 80
SfuI TTCGAA 1 cut(s) 696
SgsI GGCGCGCC 1 cut(s) 54
SinI GGWCC 1 cut(s) 207
SmiMI CAYNNNNRTG 2 cut(s) 572, 587
SmlI CTYRAG 2 cut(s) 338, 359
SmoI CTYRAG 2 cut(s) 338, 359
Sse9I AATT 1 cut(s) 29
SseBI AGGCCT 1 cut(s) 539
SsiI CCGC 5 cut(s) 59, 295, 597, 612, 657
SspDI GGCGCC 1 cut(s) 78
SspMI CTAG 3 cut(s) 162, 551, 708
StuI AGGCCT 1 cut(s) 539
StyD4I CCNGG 2 cut(s) 505, 539
TaaI ACNGT 4 cut(s) 104, 207, 461, 467
TaiI ACGT 2 cut(s) 75, 387
TaqI TCGA 4 cut(s) 14, 404, 602, 696
TasI AATT 1 cut(s) 29
TauI GCSGC 1 cut(s) 61
TfiI GAWTC 3 cut(s) 311, 454, 698
Tru1I TTAA 4 cut(s) 339, 360, 666, 678
Tru9I TTAA 4 cut(s) 339, 360, 666, 678
TscAI CASTG 3 cut(s) 49, 257, 466
TseFI GTSAC 1 cut(s) 461
TseI GCWGC 3 cut(s) 193, 355, 433
Tsp45I GTSAC 1 cut(s) 461
TspDTI ATGAA 1 cut(s) 428
TspRI CASTG 3 cut(s) 49, 257, 466
Van91I CCANNNNNTGG 1 cut(s) 522
Vha464I CTTAAG 2 cut(s) 338, 359
VpaK11BI GGWCC 1 cut(s) 207
XspI CTAG 3 cut(s) 162, 551, 708
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.