pycom12695g00020

Nudix hydrolase 3-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00012695
Physical Location & Seq
Reverse (-)
7541 .. 10257
2717 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 561 bp
ATGTACTCCAGGCATCTGGTATCATCTTTGGGGAAGAAGAAAGAATTGAGTATTTCGAAAGGCTTTGCTGGGAGTGCGCCCTCAGAGGTGAGGGAGAGTTGGGCATTTTCTTCAGGTTTGCCTTGCCATAAAAAACGAAGGTCGACATATATAGAGATAATATCAAGTGGTGGTATTGTTCTTTTACCCTTGTCGACAAACGTTTTGATCCCAGTAGCTAGGAACCTCCTCACTCCAAAAGATAGCAGGCTGCTGTCAGGACGGTCCGATGAGTTGGCCGTTCAAGAGTCCCTCGCACTTAGTGTTCAGTGTGCGAGTTCTGTGTCCAACATGGGCCAACGCCTGCTTGCCCGCTCCCGTCAGGTGGAATCATTGATGGCAGAGGTGGAAAGTCTCAAGCAGGAGATCCAGCAGCTTAAGTACGAGAATAGAAGTTTGCACGTGCTTGCAAACAACTATTCGACGGGCATGAAGAGGAAGCTTGATGAGCTGCAAGAGTCTGAAGGTCGGATTCAAAGTGACCGTCAAAGGTTTTCGTCTTTCCTCAAGAGGAACGTTTAG

Protein Analysis

187

Amino Acids

20.77

Weight (kDa)

9.9

Isoelectric Point (pI)

65.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 354
AccI GTMKAC 2 cut(s) 143, 194
AciI CCGC 1 cut(s) 352
AclI AACGTT 2 cut(s) 201, 555
AclWI GGATC 2 cut(s) 202, 400
AcoI YGGCCR 1 cut(s) 276
AcuI CTGAAG 2 cut(s) 96, 522
AcvI CACGTG 1 cut(s) 442
AdeI CACNNNGTG 1 cut(s) 302
AfaI GTAC 2 cut(s) 5, 422
AfiI CCNNNNNNNGG 1 cut(s) 364
AflII CTTAAG 1 cut(s) 416
AgsI TTSAA 2 cut(s) 284, 515
AjnI CCWGG 1 cut(s) 8
AluBI AGCT 4 cut(s) 218, 415, 481, 490
AluI AGCT 4 cut(s) 218, 415, 481, 490
Alw26I GTCTC 1 cut(s) 398
AlwI GGATC 2 cut(s) 202, 400
AoxI GGCC 2 cut(s) 276, 334
ApeKI GCWGC 3 cut(s) 250, 412, 490
ArsI GACNNNNNNTTYG 4 cut(s) 187, 219, 508, 540
AspLEI GCGC 1 cut(s) 79
AspS9I GGNCC 2 cut(s) 264, 334
AsuHPI GGTGA 1 cut(s) 100
AsuII TTCGAA 1 cut(s) 56
AvaII GGWCC 1 cut(s) 264
BbrPI CACGTG 1 cut(s) 442
BbvI GCAGC 3 cut(s) 237, 424, 477
BccI CCATC 1 cut(s) 370
BceAI ACGGC 1 cut(s) 263
BciT130I CCWGG 1 cut(s) 10
BcoDI GTCTC 1 cut(s) 398
BfaI CTAG 1 cut(s) 219
BfrI CTTAAG 1 cut(s) 416
BisI GCNGC 3 cut(s) 251, 413, 491
BlsI GCNGC 3 cut(s) 252, 414, 492
Bme1390I CCNGG 1 cut(s) 10
Bme18I GGWCC 1 cut(s) 264
BmgT120I GGNCC 2 cut(s) 264, 334
BmiI GGNNCC 1 cut(s) 224
BmrFI CCNGG 1 cut(s) 10
BmrI ACTGGG 1 cut(s) 206
BmsI GCATC 1 cut(s) 22
BmuI ACTGGG 1 cut(s) 206
Bpu14I TTCGAA 1 cut(s) 56
BpuEI CTTGAG 2 cut(s) 380, 530
BsaAI YACGTR 1 cut(s) 442
Bsc4I CCNNNNNNNGG 1 cut(s) 364
Bse1I ACTGG 1 cut(s) 212
BseBI CCWGG 1 cut(s) 10
BseLI CCNNNNNNNGG 1 cut(s) 364
BseMII CTCAG 1 cut(s) 96
BseNI ACTGG 1 cut(s) 212
BseRI GAGGAG 1 cut(s) 218
BseXI GCAGC 3 cut(s) 237, 424, 477
BseYI CCCAGC 1 cut(s) 68
BshFI GGCC 2 cut(s) 278, 336
BslFI GGGAC 1 cut(s) 274
BslI CCNNNNNNNGG 1 cut(s) 364
BsmAI GTCTC 1 cut(s) 398
BsmFI GGGAC 1 cut(s) 274
BsnI GGCC 2 cut(s) 278, 336
Bsp119I TTCGAA 1 cut(s) 56
Bsp143I GATC 2 cut(s) 207, 405
BspACI CCGC 1 cut(s) 352
BspANI GGCC 2 cut(s) 278, 336
BspCNI CTCAG 1 cut(s) 95
BspLI GGNNCC 1 cut(s) 224
BspPI GGATC 2 cut(s) 202, 400
BspT104I TTCGAA 1 cut(s) 56
BspTI CTTAAG 1 cut(s) 416
BsrBI CCGCTC 1 cut(s) 354
BsrI ACTGG 1 cut(s) 212
BssMI GATC 2 cut(s) 207, 405
Bst2UI CCWGG 1 cut(s) 10
Bst4CI ACNGT 2 cut(s) 264, 524
Bst6I CTCTTC 1 cut(s) 467
BstAFI CTTAAG 1 cut(s) 416
BstBAI YACGTR 1 cut(s) 442
BstBI TTCGAA 1 cut(s) 56
BstC8I GCNNGC 5 cut(s) 248, 344, 348, 352, 447
BstDEI CTNAG 2 cut(s) 82, 299
BstHHI GCGC 1 cut(s) 79
BstKTI GATC 2 cut(s) 210, 408
BstMAI GTCTC 1 cut(s) 398
BstMBI GATC 2 cut(s) 207, 405
BstMWI GCNNNNNNNGC 2 cut(s) 74, 487
BstNI CCWGG 1 cut(s) 10
BstSCI CCNGG 1 cut(s) 8
BstV1I GCAGC 3 cut(s) 237, 424, 477
BstX2I RGATCY 1 cut(s) 405
BstXI CCANNNNNNTGG 1 cut(s) 16
BstYI RGATCY 1 cut(s) 405
BsuRI GGCC 2 cut(s) 278, 336
BtsIMutI CAGTG 1 cut(s) 314
Cac8I GCNNGC 5 cut(s) 248, 344, 348, 352, 447
CfoI GCGC 1 cut(s) 79
Cfr13I GGNCC 2 cut(s) 264, 334
CpoI CGGWCCG 1 cut(s) 264
Csp6I GTAC 2 cut(s) 4, 421
CspI CGGWCCG 1 cut(s) 264
CviAII CATG 2 cut(s) 331, 469
CviJI RGCY 8 cut(s) 63, 218, 250, 278, 336, 415, 481, 490
CviKI_1 RGCY 8 cut(s) 63, 218, 250, 278, 336, 415, 481, 490
CviQI GTAC 2 cut(s) 4, 421
DdeI CTNAG 2 cut(s) 82, 299
DpnI GATC 2 cut(s) 209, 407
DpnII GATC 2 cut(s) 207, 405
DraIII CACNNNGTG 1 cut(s) 302
EaeI YGGCCR 1 cut(s) 276
Eam1104I CTCTTC 1 cut(s) 467
EarI CTCTTC 1 cut(s) 467
Eco47I GGWCC 1 cut(s) 264
Eco57I CTGAAG 2 cut(s) 96, 522
Eco72I CACGTG 1 cut(s) 442
EcoRII CCWGG 1 cut(s) 8
FaeI CATG 2 cut(s) 334, 472
FaiI YATR 6 cut(s) 129, 148, 150, 152, 332, 470
FaqI GGGAC 1 cut(s) 274
FatI CATG 2 cut(s) 330, 468
FauI CCCGC 1 cut(s) 359
FblI GTMKAC 2 cut(s) 143, 194
Fnu4HI GCNGC 3 cut(s) 251, 413, 491
Fsp4HI GCNGC 3 cut(s) 251, 413, 491
FspBI CTAG 1 cut(s) 219
GlaI GCGC 1 cut(s) 78
GluI GCNGC 3 cut(s) 251, 413, 491
GsaI CCCAGC 1 cut(s) 72
HaeIII GGCC 2 cut(s) 278, 336
HhaI GCGC 1 cut(s) 79
Hin1II CATG 2 cut(s) 334, 472
Hin6I GCGC 1 cut(s) 77
HinP1I GCGC 1 cut(s) 77
HincII GTYRAC 2 cut(s) 144, 195
HindII GTYRAC 2 cut(s) 144, 195
HindIII AAGCTT 1 cut(s) 479
HinfI GANTC 4 cut(s) 287, 368, 497, 511
HphI GGTGA 1 cut(s) 100
Hpy166II GTNNAC 2 cut(s) 144, 195
Hpy188I TCNGA 4 cut(s) 85, 268, 502, 510
Hpy188III TCNNGA 3 cut(s) 258, 284, 547
Hpy8I GTNNAC 2 cut(s) 144, 195
Hpy99I CGWCG 1 cut(s) 466
HpyAV CCTTC 2 cut(s) 132, 497
HpyCH4III ACNGT 2 cut(s) 264, 524
HpyCH4IV ACGT 3 cut(s) 201, 441, 555
HpyCH4V TGCA 3 cut(s) 439, 449, 493
HpyF10VI GCNNNNNNNGC 2 cut(s) 74, 487
HpyF3I CTNAG 2 cut(s) 82, 299
HpySE526I ACGT 3 cut(s) 201, 441, 555
Hsp92II CATG 2 cut(s) 334, 472
HspAI GCGC 1 cut(s) 77
Kzo9I GATC 2 cut(s) 207, 405
LmnI GCTCC 1 cut(s) 359
Lsp1109I GCAGC 3 cut(s) 237, 424, 477
LweI GCATC 1 cut(s) 22
MaeI CTAG 1 cut(s) 219
MaeII ACGT 3 cut(s) 201, 441, 555
MaeIII GTNAC 1 cut(s) 518
MalI GATC 2 cut(s) 209, 407
MbiI CCGCTC 1 cut(s) 354
MboI GATC 2 cut(s) 207, 405
MboII GAAGA 4 cut(s) 46, 49, 102, 484
MflI RGATCY 1 cut(s) 405
MluCI AATT 1 cut(s) 44
MlyI GAGTC 2 cut(s) 296, 506
MmeI TCCRAC 2 cut(s) 351, 488
MseI TTAA 1 cut(s) 417
MspCI CTTAAG 1 cut(s) 416
MspR9I CCNGG 1 cut(s) 10
MvaI CCWGG 1 cut(s) 10
MwoI GCNNNNNNNGC 2 cut(s) 74, 487
NdeII GATC 2 cut(s) 207, 405
NlaIII CATG 2 cut(s) 334, 472
NlaIV GGNNCC 1 cut(s) 224
NmuCI GTSAC 1 cut(s) 518
NspV TTCGAA 1 cut(s) 56
PfeI GAWTC 2 cut(s) 368, 511
PkrI GCNGC 3 cut(s) 252, 414, 492
PleI GAGTC 2 cut(s) 295, 505
PmaCI CACGTG 1 cut(s) 442
PmlI CACGTG 1 cut(s) 442
PpsI GAGTC 2 cut(s) 295, 505
Ppu21I YACGTR 1 cut(s) 442
Psp1406I AACGTT 2 cut(s) 201, 555
Psp6I CCWGG 1 cut(s) 8
PspCI CACGTG 1 cut(s) 442
PspFI CCCAGC 1 cut(s) 68
PspGI CCWGG 1 cut(s) 8
PspN4I GGNNCC 1 cut(s) 224
PspPI GGNCC 2 cut(s) 264, 334
PsuI RGATCY 1 cut(s) 405
RsaI GTAC 2 cut(s) 5, 422
RsaNI GTAC 2 cut(s) 4, 421
Rsr2I CGGWCCG 1 cut(s) 264
RsrII CGGWCCG 1 cut(s) 264
SalI GTCGAC 2 cut(s) 142, 193
SaqAI TTAA 1 cut(s) 417
SatI GCNGC 3 cut(s) 251, 413, 491
Sau3AI GATC 2 cut(s) 207, 405
Sau96I GGNCC 2 cut(s) 264, 334
SchI GAGTC 2 cut(s) 296, 506
ScrFI CCNGG 1 cut(s) 10
SfaNI GCATC 1 cut(s) 22
SfuI TTCGAA 1 cut(s) 56
SinI GGWCC 1 cut(s) 264
SmlI CTYRAG 3 cut(s) 395, 416, 545
SmoI CTYRAG 3 cut(s) 395, 416, 545
Sse9I AATT 1 cut(s) 44
SsiI CCGC 1 cut(s) 352
SspMI CTAG 1 cut(s) 219
StyD4I CCNGG 1 cut(s) 8
TaaI ACNGT 2 cut(s) 264, 524
TaiI ACGT 3 cut(s) 204, 444, 558
TaqI TCGA 4 cut(s) 56, 143, 194, 461
TasI AATT 1 cut(s) 44
TatI WGTACW 1 cut(s) 3
TfiI GAWTC 2 cut(s) 368, 511
Tru1I TTAA 1 cut(s) 417
Tru9I TTAA 1 cut(s) 417
TscAI CASTG 1 cut(s) 314
TseFI GTSAC 1 cut(s) 518
TseI GCWGC 3 cut(s) 250, 412, 490
Tsp45I GTSAC 1 cut(s) 518
TspDTI ATGAA 1 cut(s) 485
TspRI CASTG 1 cut(s) 314
Vha464I CTTAAG 1 cut(s) 416
VpaK11BI GGWCC 1 cut(s) 264
XmiI GTMKAC 2 cut(s) 143, 194
XspI CTAG 1 cut(s) 219
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.