pycom13g19230

Nudix hydrolase 3-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
Physical Location & Seq
Reverse (-)
15244777 .. 15245529
753 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 753 bp
ATGTCGCTTGGCTTTTTACAGAGGTATCGATCACTCCAACATACACACTCTGAAAATTGCCCATTCTTGAAAATCGTCTCCGGCCTTTTGAGAATTATCTTCATCCACCCATTCTCTCTGAACACCTTTGAAAAAATGACTAACTCATCGAACCTTTGCTTAGATTTGAGTCTCAGCAGCGATCCGGTTGCACCCGGTCAAGGTAATGTATGGCGCCCTTCTTTTTTATCTTCTAACGGTCCTCTTACAGGTGAAGACTCCGTGATGCAGGACGCCACAACAGCTACAATAGTAGCTAGGAACCTCCTCACTCCAAAAGATAGTAGGCTGCTGTCAGGACGGTCCGATGAGTTGGCCGTTCAAGAGTCCCTCGCTCTCAGCGTTCAGTGTGCAGGCTCTGTGTCCAACATGGGCCAACGCCTACTTGCTCGCTCCCGTCAGGTTGAATCGTTGATGGCAGAGGTGGAAAGTCTCAAGCAAGAGATCAAGCAGCTGAAGTATGAGAATAGAAGTTTGCACGTGCTTGCAAACAACTATTCGACGGGCATGAAGAGGAAGCTTGATGAGCTGCAAGAGTCTGAAGGTCGGATTCAAAGTGACCGTCAAAGGTTTTCGTCTTTCCTCCAGAGGCACATTTTTCCTGGGTCTTCCAGCGTTTGGCCAAGTATTGAGGCCTCGAATGCTCTATCTTCGATGCCTCCCGCTCCTGGAGTTTTGCCACGTAGTGGGGCTTCACGTGAACATCCTTTGTGA

Protein Analysis

251

Amino Acids

27.61

Weight (kDa)

8.86

Isoelectric Point (pI)

61.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 213
AccB7I CCANNNNNTGG 2 cut(s) 657, 725
AccBSI CCGCTC 1 cut(s) 704
AciI CCGC 1 cut(s) 702
AclWI GGATC 1 cut(s) 176
AcoI YGGCCR 2 cut(s) 354, 659
AcuI CTGAAG 2 cut(s) 515, 600
AcvI CACGTG 2 cut(s) 520, 737
AcyI GRCGYC 2 cut(s) 214, 273
AdeI CACNNNGTG 1 cut(s) 725
AfiI CCNNNNNNNGG 5 cut(s) 200, 248, 657, 707, 725
AgsI TTSAA 5 cut(s) 70, 131, 362, 446, 593
AjnI CCWGG 2 cut(s) 640, 706
AluBI AGCT 5 cut(s) 284, 296, 493, 559, 568
AluI AGCT 5 cut(s) 284, 296, 493, 559, 568
Alw26I GTCTC 3 cut(s) 82, 176, 476
AlwI GGATC 1 cut(s) 176
AlwNI CAGNNNCTG 1 cut(s) 398
AoxI GGCC 5 cut(s) 82, 354, 412, 659, 672
ApeKI GCWGC 4 cut(s) 177, 328, 490, 568
ArsI GACNNNNNNTTYG 2 cut(s) 586, 618
AspLEI GCGC 1 cut(s) 216
AspS9I GGNCC 3 cut(s) 239, 342, 412
AsuC2I CCSGG 1 cut(s) 195
AsuHPI GGTGA 1 cut(s) 263
AvaII GGWCC 2 cut(s) 239, 342
BaeI ACNNNNGTAYC 2 cut(s) 8, 41
BalI TGGCCA 1 cut(s) 661
BanI GGYRCC 1 cut(s) 213
BarI GAAGNNNNNNTAC 2 cut(s) 715, 747
BbrPI CACGTG 2 cut(s) 520, 737
BbsI GAAGAC 2 cut(s) 261, 639
BbvI GCAGC 4 cut(s) 189, 315, 502, 555
BccI CCATC 1 cut(s) 448
BceAI ACGGC 1 cut(s) 341
BcgI CGANNNNNNTGC 2 cut(s) 170, 204
BciT130I CCWGG 2 cut(s) 642, 708
BcnI CCSGG 1 cut(s) 195
BcoDI GTCTC 3 cut(s) 82, 176, 476
BfaI CTAG 1 cut(s) 297
BfoI RGCGCY 1 cut(s) 217
BisI GCNGC 4 cut(s) 178, 329, 491, 569
BlsI GCNGC 4 cut(s) 179, 330, 492, 570
Bme1390I CCNGG 3 cut(s) 195, 642, 708
Bme18I GGWCC 2 cut(s) 239, 342
BmgT120I GGNCC 3 cut(s) 239, 342, 412
BmiI GGNNCC 2 cut(s) 215, 302
BmrFI CCNGG 3 cut(s) 195, 642, 708
BmsI GCATC 2 cut(s) 255, 684
BpiI GAAGAC 2 cut(s) 261, 639
BpmI CTGGAG 2 cut(s) 608, 729
BpuEI CTTGAG 1 cut(s) 458
BpuMI CCSGG 1 cut(s) 195
Bsa29I ATCGAT 1 cut(s) 28
BsaAI YACGTR 3 cut(s) 520, 722, 737
BsaHI GRCGYC 2 cut(s) 214, 273
BsaJI CCNNGG 1 cut(s) 641
BsaWI WCCGGW 1 cut(s) 184
Bsc4I CCNNNNNNNGG 5 cut(s) 200, 248, 657, 707, 725
BseBI CCWGG 2 cut(s) 642, 708
BseCI ATCGAT 1 cut(s) 28
BseDI CCNNGG 1 cut(s) 641
BseGI GGATG 2 cut(s) 102, 742
BseLI CCNNNNNNNGG 5 cut(s) 200, 248, 657, 707, 725
BseMII CTCAG 2 cut(s) 187, 391
BseRI GAGGAG 1 cut(s) 296
BseXI GCAGC 4 cut(s) 189, 315, 502, 555
BsgI GTGCAG 1 cut(s) 411
BshFI GGCC 5 cut(s) 84, 356, 414, 661, 674
BshNI GGYRCC 1 cut(s) 213
BshVI ATCGAT 1 cut(s) 28
BsiSI CCGG 3 cut(s) 81, 185, 195
BslFI GGGAC 1 cut(s) 352
BslI CCNNNNNNNGG 5 cut(s) 200, 248, 657, 707, 725
BsmAI GTCTC 3 cut(s) 82, 176, 476
BsmBI CGTCTC 1 cut(s) 82
BsmFI GGGAC 1 cut(s) 352
BsmI GAATGC 1 cut(s) 685
BsnI GGCC 5 cut(s) 84, 356, 414, 661, 674
Bsp143I GATC 3 cut(s) 29, 181, 483
BspACI CCGC 1 cut(s) 702
BspANI GGCC 5 cut(s) 84, 356, 414, 661, 674
BspCNI CTCAG 2 cut(s) 186, 390
BspDI ATCGAT 1 cut(s) 28
BspLI GGNNCC 2 cut(s) 215, 302
BspPI GGATC 1 cut(s) 176
BspT107I GGYRCC 1 cut(s) 213
BsrBI CCGCTC 1 cut(s) 704
BssECI CCNNGG 1 cut(s) 641
BssMI GATC 3 cut(s) 29, 181, 483
BssNI GRCGYC 2 cut(s) 214, 273
Bst2UI CCWGG 2 cut(s) 642, 708
Bst4CI ACNGT 3 cut(s) 239, 342, 602
Bst6I CTCTTC 1 cut(s) 545
BstACI GRCGYC 2 cut(s) 214, 273
BstBAI YACGTR 3 cut(s) 520, 722, 737
BstC8I GCNNGC 3 cut(s) 394, 430, 525
BstDEI CTNAG 3 cut(s) 160, 173, 377
BstENI CCTNNNNNAGG 1 cut(s) 246
BstF5I GGATG 2 cut(s) 102, 742
BstH2I RGCGCY 1 cut(s) 217
BstHHI GCGC 1 cut(s) 216
BstKTI GATC 3 cut(s) 32, 184, 486
BstMAI GTCTC 3 cut(s) 82, 176, 476
BstMBI GATC 3 cut(s) 29, 181, 483
BstMWI GCNNNNNNNGC 3 cut(s) 281, 565, 680
BstNI CCWGG 2 cut(s) 642, 708
BstSCI CCNGG 3 cut(s) 193, 640, 706
BstV1I GCAGC 4 cut(s) 189, 315, 502, 555
BstV2I GAAGAC 2 cut(s) 261, 639
Bsu15I ATCGAT 1 cut(s) 28
BsuRI GGCC 5 cut(s) 84, 356, 414, 661, 674
BsuTUI ATCGAT 1 cut(s) 28
BtsCI GGATG 2 cut(s) 102, 742
BtsIMutI CAGTG 1 cut(s) 392
Cac8I GCNNGC 3 cut(s) 394, 430, 525
CaiI CAGNNNCTG 1 cut(s) 398
CfoI GCGC 1 cut(s) 216
Cfr13I GGNCC 3 cut(s) 239, 342, 412
ClaI ATCGAT 1 cut(s) 28
CpoI CGGWCCG 1 cut(s) 342
CseI GACGC 1 cut(s) 281
CspI CGGWCCG 1 cut(s) 342
CviAII CATG 2 cut(s) 409, 547
DdeI CTNAG 3 cut(s) 160, 173, 377
DinI GGCGCC 1 cut(s) 215
DpnI GATC 3 cut(s) 31, 183, 485
DpnII GATC 3 cut(s) 29, 181, 483
DraIII CACNNNGTG 1 cut(s) 725
EaeI YGGCCR 2 cut(s) 354, 659
Eam1104I CTCTTC 1 cut(s) 545
EarI CTCTTC 1 cut(s) 545
Eco147I AGGCCT 1 cut(s) 674
Eco47I GGWCC 2 cut(s) 239, 342
Eco57I CTGAAG 2 cut(s) 515, 600
Eco72I CACGTG 2 cut(s) 520, 737
EcoNI CCTNNNNNAGG 1 cut(s) 246
EcoRII CCWGG 2 cut(s) 640, 706
EgeI GGCGCC 1 cut(s) 215
EheI GGCGCC 1 cut(s) 215
Esp3I CGTCTC 1 cut(s) 82
FaeI CATG 2 cut(s) 412, 550
FaiI YATR 5 cut(s) 42, 211, 410, 501, 548
FaqI GGGAC 1 cut(s) 352
FatI CATG 2 cut(s) 408, 546
FauI CCCGC 1 cut(s) 709
Fnu4HI GCNGC 4 cut(s) 178, 329, 491, 569
FokI GGATG 2 cut(s) 89, 729
Fsp4HI GCNGC 4 cut(s) 178, 329, 491, 569
FspBI CTAG 1 cut(s) 297
GlaI GCGC 1 cut(s) 215
GluI GCNGC 4 cut(s) 178, 329, 491, 569
GsuI CTGGAG 2 cut(s) 608, 729
HaeII RGCGCY 1 cut(s) 217
HaeIII GGCC 5 cut(s) 84, 356, 414, 661, 674
HapII CCGG 3 cut(s) 81, 185, 195
HgaI GACGC 1 cut(s) 281
HhaI GCGC 1 cut(s) 216
Hin1I GRCGYC 2 cut(s) 214, 273
Hin1II CATG 2 cut(s) 412, 550
Hin6I GCGC 1 cut(s) 214
HinP1I GCGC 1 cut(s) 214
HindIII AAGCTT 1 cut(s) 557
HinfI GANTC 6 cut(s) 169, 257, 365, 446, 575, 589
HpaII CCGG 3 cut(s) 81, 185, 195
HphI GGTGA 1 cut(s) 263
Hpy166II GTNNAC 1 cut(s) 740
Hpy188I TCNGA 5 cut(s) 52, 120, 346, 580, 588
Hpy188III TCNNGA 4 cut(s) 67, 336, 362, 625
Hpy8I GTNNAC 1 cut(s) 740
Hpy99I CGWCG 1 cut(s) 544
HpyAV CCTTC 2 cut(s) 228, 575
HpyCH4III ACNGT 3 cut(s) 239, 342, 602
HpyCH4IV ACGT 3 cut(s) 519, 721, 736
HpyCH4V TGCA 6 cut(s) 191, 268, 392, 517, 527, 571
HpyF10VI GCNNNNNNNGC 3 cut(s) 281, 565, 680
HpyF3I CTNAG 3 cut(s) 160, 173, 377
HpySE526I ACGT 3 cut(s) 519, 721, 736
Hsp92I GRCGYC 2 cut(s) 214, 273
Hsp92II CATG 2 cut(s) 412, 550
HspAI GCGC 1 cut(s) 214
KasI GGCGCC 1 cut(s) 213
Kzo9I GATC 3 cut(s) 29, 181, 483
LmnI GCTCC 2 cut(s) 437, 709
Lsp1109I GCAGC 4 cut(s) 189, 315, 502, 555
LweI GCATC 2 cut(s) 255, 684
MaeI CTAG 1 cut(s) 297
MaeII ACGT 3 cut(s) 519, 721, 736
MaeIII GTNAC 1 cut(s) 596
MalI GATC 3 cut(s) 31, 183, 485
MbiI CCGCTC 1 cut(s) 704
MboI GATC 3 cut(s) 29, 181, 483
MboII GAAGA 6 cut(s) 91, 222, 266, 562, 639, 681
MlsI TGGCCA 1 cut(s) 661
MluCI AATT 2 cut(s) 55, 93
MluNI TGGCCA 1 cut(s) 661
Mly113I GGCGCC 1 cut(s) 214
MlyI GAGTC 4 cut(s) 178, 251, 374, 584
MmeI TCCRAC 3 cut(s) 61, 429, 566
Mox20I TGGCCA 1 cut(s) 661
MscI TGGCCA 1 cut(s) 661
Msp20I TGGCCA 1 cut(s) 661
MspA1I CMGCKG 1 cut(s) 493
MspI CCGG 3 cut(s) 81, 185, 195
MspR9I CCNGG 3 cut(s) 195, 642, 708
Mva1269I GAATGC 1 cut(s) 685
MvaI CCWGG 2 cut(s) 642, 708
MwoI GCNNNNNNNGC 3 cut(s) 281, 565, 680
NarI GGCGCC 1 cut(s) 214
NciI CCSGG 1 cut(s) 195
NdeII GATC 3 cut(s) 29, 181, 483
NlaIII CATG 2 cut(s) 412, 550
NlaIV GGNNCC 2 cut(s) 215, 302
NmuCI GTSAC 1 cut(s) 596
PceI AGGCCT 1 cut(s) 674
PcsI WCGNNNNNNNCGW 1 cut(s) 378
PctI GAATGC 1 cut(s) 685
PfeI GAWTC 2 cut(s) 446, 589
PflMI CCANNNNNTGG 2 cut(s) 657, 725
PfoI TCCNGGA 1 cut(s) 706
PkrI GCNGC 4 cut(s) 179, 330, 492, 570
PleI GAGTC 4 cut(s) 177, 251, 373, 583
PluTI GGCGCC 1 cut(s) 217
PmaCI CACGTG 2 cut(s) 520, 737
PmlI CACGTG 2 cut(s) 520, 737
PpsI GAGTC 4 cut(s) 177, 251, 373, 583
Ppu21I YACGTR 3 cut(s) 520, 722, 737
Psp6I CCWGG 2 cut(s) 640, 706
PspCI CACGTG 2 cut(s) 520, 737
PspGI CCWGG 2 cut(s) 640, 706
PspN4I GGNNCC 2 cut(s) 215, 302
PspPI GGNCC 3 cut(s) 239, 342, 412
PstNI CAGNNNCTG 1 cut(s) 398
PvuII CAGCTG 1 cut(s) 493
Rsr2I CGGWCCG 1 cut(s) 342
RsrII CGGWCCG 1 cut(s) 342
SatI GCNGC 4 cut(s) 178, 329, 491, 569
Sau3AI GATC 3 cut(s) 29, 181, 483
Sau96I GGNCC 3 cut(s) 239, 342, 412
SchI GAGTC 4 cut(s) 178, 251, 374, 584
ScrFI CCNGG 3 cut(s) 195, 642, 708
SfaNI GCATC 2 cut(s) 255, 684
SfoI GGCGCC 1 cut(s) 215
SinI GGWCC 2 cut(s) 239, 342
SmlI CTYRAG 1 cut(s) 473
SmoI CTYRAG 1 cut(s) 473
Sse9I AATT 2 cut(s) 55, 93
SseBI AGGCCT 1 cut(s) 674
SsiI CCGC 1 cut(s) 702
SspDI GGCGCC 1 cut(s) 213
SspMI CTAG 1 cut(s) 297
StuI AGGCCT 1 cut(s) 674
StyD4I CCNGG 3 cut(s) 193, 640, 706
TaaI ACNGT 3 cut(s) 239, 342, 602
TaiI ACGT 3 cut(s) 522, 724, 739
TaqI TCGA 5 cut(s) 28, 149, 539, 677, 692
TasI AATT 2 cut(s) 55, 93
TfiI GAWTC 2 cut(s) 446, 589
TscAI CASTG 1 cut(s) 392
TseFI GTSAC 1 cut(s) 596
TseI GCWGC 4 cut(s) 177, 328, 490, 568
Tsp45I GTSAC 1 cut(s) 596
TspDTI ATGAA 2 cut(s) 91, 563
TspGWI ACGGA 1 cut(s) 250
TspRI CASTG 1 cut(s) 392
Van91I CCANNNNNTGG 2 cut(s) 657, 725
VpaK11BI GGWCC 2 cut(s) 239, 342
XagI CCTNNNNNAGG 1 cut(s) 246
XspI CTAG 1 cut(s) 297
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.