pycom13g25290

ethylene-responsive transcription factor

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
Physical Location & Seq
Forward (+)
22150837 .. 22152081
1245 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 987 bp
ATGAATCAGCACGTGTTTGTTATGCTTGTCTCTACATGCTTCAATTTTCACTTGCCTTACTTGTTCCCCTTGCATAAGTGGTATTTTCCCTGGTTTTCCCTCATGCATGTTGGAATGCAAACCTTGCATTTGAAATGTCCTTCACTTCTTGGTGACTCATCCATGCGTGGCAACTTCAGTGTAAAAAACCTAGCTCCACCAGCAGTTGAAGATGAGTACTCGAGAGCAATTCTAGGTGAGCAATCAGGAAAGGTTCCAAGCAGTCGGTTCCTTACCGAAAGTTTGAGTGGAGGTTTCAACATATTGCTTTATATATCCTTGTTTTTGCAGGTAAGAACAAGGGCAAAGGAAATGACAGGGAGATTGCATGATATGAGATACTCTTGTTCTCGAAGAAAACTGAGTATTTCGAGATACTTTGTTGAAGATGCATTCTCGAATATGAGGACGATTTTCAAAAGCATGCAGTGGTGTTGTGCCTTTACTCTTGTCGGCAACTGTGGTGTAATTAGAACAATAAGATTTACGCGTTTTCAACTTTGTCAGAGATCTTTGACAAAGTTGCACGCGATATCTGAAAAAGCTGAGATTGCGTCTGAAAAATGCCAACAAACTTTATTCAGGAAAATCTGGCTTTTGAAATTCAAAGAGCGATACATCAATTGTGTTCAAGAGTATGCTCAGAAAGTTACTGCCTGTAGAAATTTTCCCCTTTCTTGCACTTCTGAGATTTTATTTGACCTCATTTTTCCTTCCTCATTTCTGAAAATAGCTTGCCCATCTAACATTTGTTTAGATTTGAGTCTTAGAAGTGATACAGACGAGCAGCGTCAAGATAATATATGGCGCCCATCCTTCTTATTTTCTAATGGTCCTCTTACAGTTGGGGACTATGTGATGAAGAATAACATAACCGCTACTGTGGTAGCTAGGAATCTTCTCACTCCAAGGGATAACATAATCCTTTCAAAACGGTCCGATGAGTAG

Protein Analysis

329

Amino Acids

37.94

Weight (kDa)

9.36

Isoelectric Point (pI)

51.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 319
AccB1I GGYRCC 1 cut(s) 846
AccII CGCG 2 cut(s) 529, 569
AciI CCGC 1 cut(s) 915
AcsI RAATTY 2 cut(s) 641, 703
AcuI CTGAAG 1 cut(s) 160
AcvI CACGTG 1 cut(s) 13
AcyI GRCGYC 1 cut(s) 847
AfaI GTAC 1 cut(s) 218
AflIII ACRYGT 2 cut(s) 12, 527
AjnI CCWGG 1 cut(s) 89
AluBI AGCT 4 cut(s) 194, 584, 773, 929
AluI AGCT 4 cut(s) 194, 584, 773, 929
Alw26I GTCTC 1 cut(s) 34
Ama87I CYCGRG 1 cut(s) 220
ApeKI GCWGC 1 cut(s) 826
ApoI RAATTY 2 cut(s) 641, 703
AspLEI GCGC 1 cut(s) 849
AspS9I GGNCC 2 cut(s) 872, 975
AsuHPI GGTGA 2 cut(s) 164, 248
AvaI CYCGRG 1 cut(s) 220
AvaII GGWCC 2 cut(s) 872, 975
BaeI ACNNNNGTAYC 2 cut(s) 370, 403
BanI GGYRCC 1 cut(s) 846
BbrPI CACGTG 1 cut(s) 13
BbvI GCAGC 1 cut(s) 838
BccI CCATC 2 cut(s) 787, 859
BciT130I CCWGG 1 cut(s) 91
BcoDI GTCTC 1 cut(s) 34
BfaI CTAG 3 cut(s) 191, 233, 930
BfmI CTRYAG 1 cut(s) 697
BfoI RGCGCY 1 cut(s) 850
BfuAI ACCTGC 1 cut(s) 319
BglII AGATCT 1 cut(s) 548
BisI GCNGC 1 cut(s) 827
BlsI GCNGC 1 cut(s) 828
BmcAI AGTACT 1 cut(s) 218
Bme1390I CCNGG 1 cut(s) 91
Bme18I GGWCC 2 cut(s) 872, 975
BmeT110I CYCGRG 1 cut(s) 220
BmgT120I GGNCC 2 cut(s) 872, 975
BmiI GGNNCC 3 cut(s) 255, 269, 848
BmrFI CCNGG 1 cut(s) 91
BmsI GCATC 1 cut(s) 418
BsaAI YACGTR 1 cut(s) 13
BsaHI GRCGYC 1 cut(s) 847
BsaJI CCNNGG 2 cut(s) 89, 947
BseBI CCWGG 1 cut(s) 91
BseDI CCNNGG 2 cut(s) 89, 947
BseGI GGATG 2 cut(s) 158, 851
BseMII CTCAG 4 cut(s) 392, 576, 695, 717
BseXI GCAGC 1 cut(s) 838
Bsh1236I CGCG 2 cut(s) 529, 569
BshNI GGYRCC 1 cut(s) 846
BsiHKCI CYCGRG 1 cut(s) 220
BslFI GGGAC 1 cut(s) 902
BsmAI GTCTC 1 cut(s) 34
BsmFI GGGAC 1 cut(s) 902
BsmI GAATGC 2 cut(s) 120, 431
BsoBI CYCGRG 1 cut(s) 220
Bsp143I GATC 1 cut(s) 548
BspACI CCGC 1 cut(s) 915
BspCNI CTCAG 4 cut(s) 393, 577, 694, 718
BspFNI CGCG 2 cut(s) 529, 569
BspLI GGNNCC 3 cut(s) 255, 269, 848
BspMI ACCTGC 1 cut(s) 319
BspT107I GGYRCC 1 cut(s) 846
BssECI CCNNGG 2 cut(s) 89, 947
BssMI GATC 1 cut(s) 548
BssNI GRCGYC 1 cut(s) 847
BssT1I CCWWGG 1 cut(s) 947
Bst2UI CCWGG 1 cut(s) 91
Bst4CI ACNGT 4 cut(s) 500, 883, 922, 975
BstACI GRCGYC 1 cut(s) 847
BstAPI GCANNNNNTGC 1 cut(s) 124
BstBAI YACGTR 1 cut(s) 13
BstC8I GCNNGC 3 cut(s) 464, 567, 775
BstDEI CTNAG 5 cut(s) 401, 585, 681, 726, 806
BstF5I GGATG 2 cut(s) 158, 851
BstFNI CGCG 2 cut(s) 529, 569
BstH2I RGCGCY 1 cut(s) 850
BstHHI GCGC 1 cut(s) 849
BstKTI GATC 1 cut(s) 551
BstMAI GTCTC 1 cut(s) 34
BstMBI GATC 1 cut(s) 548
BstMWI GCNNNNNNNGC 3 cut(s) 124, 200, 590
BstNI CCWGG 1 cut(s) 91
BstNSI RCATGY 3 cut(s) 39, 110, 466
BstSCI CCNGG 1 cut(s) 89
BstSFI CTRYAG 1 cut(s) 697
BstUI CGCG 2 cut(s) 529, 569
BstV1I GCAGC 1 cut(s) 838
BstX2I RGATCY 1 cut(s) 548
BstYI RGATCY 1 cut(s) 548
BtsCI GGATG 2 cut(s) 158, 851
BtsI GCAGTG 1 cut(s) 473
BtsIMutI CAGTG 2 cut(s) 184, 473
BveI ACCTGC 1 cut(s) 319
Cac8I GCNNGC 3 cut(s) 464, 567, 775
CfoI GCGC 1 cut(s) 849
Cfr13I GGNCC 2 cut(s) 872, 975
CpoI CGGWCCG 1 cut(s) 975
CseI GACGC 2 cut(s) 582, 818
Csp6I GTAC 1 cut(s) 217
CspI CGGWCCG 1 cut(s) 975
CviAII CATG 6 cut(s) 36, 103, 107, 163, 368, 463
CviJI RGCY 5 cut(s) 194, 584, 634, 773, 929
CviKI_1 RGCY 5 cut(s) 194, 584, 634, 773, 929
CviQI GTAC 1 cut(s) 217
DdeI CTNAG 5 cut(s) 401, 585, 681, 726, 806
DinI GGCGCC 1 cut(s) 848
DpnI GATC 1 cut(s) 550
DpnII GATC 1 cut(s) 548
Eco130I CCWWGG 1 cut(s) 947
Eco32I GATATC 1 cut(s) 573
Eco47I GGWCC 2 cut(s) 872, 975
Eco57I CTGAAG 1 cut(s) 160
Eco72I CACGTG 1 cut(s) 13
Eco88I CYCGRG 1 cut(s) 220
EcoRII CCWGG 1 cut(s) 89
EcoRV GATATC 1 cut(s) 573
EcoT14I CCWWGG 1 cut(s) 947
EcoT22I ATGCAT 2 cut(s) 108, 433
EgeI GGCGCC 1 cut(s) 848
EheI GGCGCC 1 cut(s) 848
ErhI CCWWGG 1 cut(s) 947
FaeI CATG 6 cut(s) 39, 106, 110, 166, 371, 466
FaqI GGGAC 1 cut(s) 902
FatI CATG 6 cut(s) 35, 102, 106, 162, 367, 462
Fnu4HI GCNGC 1 cut(s) 827
FokI GGATG 2 cut(s) 145, 838
Fsp4HI GCNGC 1 cut(s) 827
FspBI CTAG 3 cut(s) 191, 233, 930
GlaI GCGC 1 cut(s) 848
GluI GCNGC 1 cut(s) 827
HaeII RGCGCY 1 cut(s) 850
HgaI GACGC 2 cut(s) 582, 818
HhaI GCGC 1 cut(s) 849
Hin1I GRCGYC 1 cut(s) 847
Hin1II CATG 6 cut(s) 39, 106, 110, 166, 371, 466
Hin6I GCGC 1 cut(s) 847
HinP1I GCGC 1 cut(s) 847
HinfI GANTC 4 cut(s) 4, 155, 802, 934
HphI GGTGA 2 cut(s) 164, 248
Hpy188I TCNGA 7 cut(s) 546, 577, 598, 684, 727, 765, 979
Hpy188III TCNNGA 8 cut(s) 222, 246, 390, 411, 436, 622, 671, 833
HpyAV CCTTC 3 cut(s) 150, 762, 865
HpyCH4III ACNGT 4 cut(s) 500, 883, 922, 975
HpyCH4IV ACGT 1 cut(s) 12
HpyF10VI GCNNNNNNNGC 3 cut(s) 124, 200, 590
HpyF3I CTNAG 5 cut(s) 401, 585, 681, 726, 806
HpySE526I ACGT 1 cut(s) 12
Hsp92I GRCGYC 1 cut(s) 847
Hsp92II CATG 6 cut(s) 39, 106, 110, 166, 371, 466
HspAI GCGC 1 cut(s) 847
KasI GGCGCC 1 cut(s) 846
Kzo9I GATC 1 cut(s) 548
LmnI GCTCC 1 cut(s) 199
LpnPI CCDG 9 cut(s) 76, 103, 213, 231, 314, 342, 607, 616, 709
Lsp1109I GCAGC 1 cut(s) 838
LweI GCATC 1 cut(s) 418
MaeI CTAG 3 cut(s) 191, 233, 930
MaeII ACGT 1 cut(s) 12
MaeIII GTNAC 2 cut(s) 152, 688
MalI GATC 1 cut(s) 550
MboI GATC 1 cut(s) 548
MboII GAAGA 5 cut(s) 221, 405, 437, 913, 929
MfeI CAATTG 1 cut(s) 661
MflI RGATCY 1 cut(s) 548
MluCI AATT 6 cut(s) 43, 228, 507, 641, 661, 703
MluI ACGCGT 1 cut(s) 527
Mly113I GGCGCC 1 cut(s) 847
MlyI GAGTC 2 cut(s) 149, 811
MmeI TCCRAC 1 cut(s) 91
MnlI CCTC 6 cut(s) 110, 284, 438, 752, 766, 885
Mph1103I ATGCAT 2 cut(s) 108, 433
MspR9I CCNGG 1 cut(s) 91
MunI CAATTG 1 cut(s) 661
Mva1269I GAATGC 2 cut(s) 120, 431
MvaI CCWGG 1 cut(s) 91
MvnI CGCG 2 cut(s) 529, 569
MwoI GCNNNNNNNGC 3 cut(s) 124, 200, 590
NarI GGCGCC 1 cut(s) 847
NdeII GATC 1 cut(s) 548
NlaIII CATG 6 cut(s) 39, 106, 110, 166, 371, 466
NlaIV GGNNCC 3 cut(s) 255, 269, 848
NmuCI GTSAC 1 cut(s) 152
NsiI ATGCAT 2 cut(s) 108, 433
NspI RCATGY 3 cut(s) 39, 110, 466
PaeI GCATGC 1 cut(s) 466
PaeR7I CTCGAG 1 cut(s) 220
PctI GAATGC 2 cut(s) 120, 431
PfeI GAWTC 2 cut(s) 4, 934
PkrI GCNGC 1 cut(s) 828
PleI GAGTC 2 cut(s) 149, 810
PluTI GGCGCC 1 cut(s) 850
PmaCI CACGTG 1 cut(s) 13
PmlI CACGTG 1 cut(s) 13
PpsI GAGTC 2 cut(s) 149, 810
Ppu21I YACGTR 1 cut(s) 13
Psp6I CCWGG 1 cut(s) 89
PspCI CACGTG 1 cut(s) 13
PspGI CCWGG 1 cut(s) 89
PspN4I GGNNCC 3 cut(s) 255, 269, 848
PspPI GGNCC 2 cut(s) 872, 975
PsuI RGATCY 1 cut(s) 548
RsaI GTAC 1 cut(s) 218
RsaNI GTAC 1 cut(s) 217
Rsr2I CGGWCCG 1 cut(s) 975
RsrII CGGWCCG 1 cut(s) 975
SatI GCNGC 1 cut(s) 827
Sau3AI GATC 1 cut(s) 548
Sau96I GGNCC 2 cut(s) 872, 975
ScaI AGTACT 1 cut(s) 218
SchI GAGTC 2 cut(s) 149, 811
ScrFI CCNGG 1 cut(s) 91
SfaNI GCATC 1 cut(s) 418
SfcI CTRYAG 1 cut(s) 697
SfoI GGCGCC 1 cut(s) 848
Sfr274I CTCGAG 1 cut(s) 220
SinI GGWCC 2 cut(s) 872, 975
SlaI CTCGAG 1 cut(s) 220
SmlI CTYRAG 1 cut(s) 220
SmoI CTYRAG 1 cut(s) 220
SphI GCATGC 1 cut(s) 466
Sse9I AATT 6 cut(s) 43, 228, 507, 641, 661, 703
SsiI CCGC 1 cut(s) 915
SspDI GGCGCC 1 cut(s) 846
SspMI CTAG 3 cut(s) 191, 233, 930
StyD4I CCNGG 1 cut(s) 89
StyI CCWWGG 1 cut(s) 947
TaaI ACNGT 4 cut(s) 500, 883, 922, 975
TaiI ACGT 1 cut(s) 15
TaqI TCGA 4 cut(s) 221, 391, 410, 437
TasI AATT 6 cut(s) 43, 228, 507, 641, 661, 703
TatI WGTACW 1 cut(s) 216
TfiI GAWTC 2 cut(s) 4, 934
TscAI CASTG 2 cut(s) 184, 473
TseFI GTSAC 1 cut(s) 152
TseI GCWGC 1 cut(s) 826
Tsp45I GTSAC 1 cut(s) 152
TspDTI ATGAA 2 cut(s) 17, 914
TspRI CASTG 2 cut(s) 184, 473
VpaK11BI GGWCC 2 cut(s) 872, 975
XapI RAATTY 2 cut(s) 641, 703
XceI RCATGY 3 cut(s) 39, 110, 466
XhoI CTCGAG 1 cut(s) 220
XspI CTAG 3 cut(s) 191, 233, 930
ZrmI AGTACT 1 cut(s) 218
Zsp2I ATGCAT 2 cut(s) 108, 433
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.