pycom14g01730

ethylene-responsive transcription factor

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr14
Physical Location & Seq
Reverse (-)
1273861 .. 1274478
618 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 618 bp
ATGGCTTGCCCATCTAACCTTTGTTTAGATTTGAGTCTCGAGAAAGATACAGACGAGCCGTATCAAGATAATATATGGCGCCCGTCCTTCTTCTCTTTTAATGGTCATCTTACGGTTGGGGACTCTGTGATGAAGAATGACCTAACCGCTACAGTGGTAACTAGGAATCTTCTCACTCCCAAGGATAACAGAATCTTTTCAAACCGATCTGATGAGTCGGCCATTCAAGACTCATTGGCTCTCAGTATTCATTGTGCGGGCTCTGTTTCTAATATGGGCCAACGTCTACTTGCTCGAACTCACCAAGTTGAATCATTGATGGCTGAGGTGGCAAGTCTTAAACAAGAGATTAGAGGGCCCAAGCACGAGAATAGAGCGTTACACATGCTTGCAAATAATTACTCGACGAACATGAAAAGAAAGCTCGACCAGCTACTGGAAGCCAAAGGTCGGATTCAAAATGACAATCAGGGGTTCGAGTCTTTATTCCAAAGAGACCTATTGTCTCAGCCGTCTGGAGTTTCACCAAGTACTGAGGCTCCAAATAATCAACCTCTACTGCCTTCCTCTTTTGGGGTACTTCCGAGTACTGAGGCTTCACATGAGCAATCTTTGTGA

Protein Analysis

206

Amino Acids

22.72

Weight (kDa)

5.66

Isoelectric Point (pI)

47.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 78
AccB7I CCANNNNNTGG 1 cut(s) 436
AccI GTMKAC 1 cut(s) 286
AciI CCGC 2 cut(s) 147, 257
AcoI YGGCCR 1 cut(s) 219
AcyI GRCGYC 1 cut(s) 79
AfaI GTAC 3 cut(s) 532, 579, 589
AfiI CCNNNNNNNGG 3 cut(s) 436, 450, 573
AgsI TTSAA 4 cut(s) 201, 227, 311, 458
AhdI GACNNNNNGTC 1 cut(s) 502
AluBI AGCT 2 cut(s) 424, 433
AluI AGCT 2 cut(s) 424, 433
Alw26I GTCTC 3 cut(s) 41, 489, 510
AlwNI CAGNNNCTG 1 cut(s) 436
Ama87I CYCGRG 1 cut(s) 38
AoxI GGCC 3 cut(s) 219, 277, 356
ApaI GGGCCC 1 cut(s) 360
Asp700I GAANNNNTTC 1 cut(s) 196
AspLEI GCGC 1 cut(s) 81
AspS9I GGNCC 3 cut(s) 277, 356, 357
AsuHPI GGTGA 2 cut(s) 293, 516
AvaI CYCGRG 1 cut(s) 38
BaeGI GKGCMC 1 cut(s) 360
BanI GGYRCC 1 cut(s) 78
BanII GRGCYC 2 cut(s) 263, 360
BarI GAAGNNNNNNTAC 2 cut(s) 580, 612
BauI CACGAG 1 cut(s) 365
BbvCI CCTCAGC 1 cut(s) 324
BccI CCATC 2 cut(s) 19, 313
BceAI ACGGC 2 cut(s) 43, 496
BcoDI GTCTC 3 cut(s) 41, 489, 510
BfaI CTAG 1 cut(s) 162
BfmI CTRYAG 1 cut(s) 150
BfoI RGCGCY 1 cut(s) 82
BmcAI AGTACT 2 cut(s) 532, 589
BmeRI GACNNNNNGTC 1 cut(s) 502
BmeT110I CYCGRG 1 cut(s) 38
BmgT120I GGNCC 3 cut(s) 277, 356, 357
BmiI GGNNCC 3 cut(s) 80, 358, 540
BpmI CTGGAG 1 cut(s) 537
Bpu10I CCTNAGC 1 cut(s) 324
BsaHI GRCGYC 1 cut(s) 79
BsaI GGTCTC 1 cut(s) 489
BsaJI CCNNGG 1 cut(s) 180
BsaXI ACNNNNNCTCC 2 cut(s) 523, 553
Bsc4I CCNNNNNNNGG 3 cut(s) 436, 450, 573
Bse1I ACTGG 1 cut(s) 441
BseDI CCNNGG 1 cut(s) 180
BseLI CCNNNNNNNGG 3 cut(s) 436, 450, 573
BseMII CTCAG 5 cut(s) 256, 315, 521, 525, 582
BseNI ACTGG 1 cut(s) 441
BseSI GKGCMC 1 cut(s) 360
BshFI GGCC 3 cut(s) 221, 279, 358
BshNI GGYRCC 1 cut(s) 78
BsiHKCI CYCGRG 1 cut(s) 38
BslFI GGGAC 1 cut(s) 134
BslI CCNNNNNNNGG 3 cut(s) 436, 450, 573
BsmAI GTCTC 3 cut(s) 41, 489, 510
BsmFI GGGAC 1 cut(s) 134
BsnI GGCC 3 cut(s) 221, 279, 358
Bso31I GGTCTC 1 cut(s) 489
BsoBI CYCGRG 1 cut(s) 38
Bsp120I GGGCCC 1 cut(s) 356
Bsp1286I GDGCHC 2 cut(s) 263, 360
Bsp143I GATC 1 cut(s) 206
BspACI CCGC 2 cut(s) 147, 257
BspANI GGCC 3 cut(s) 221, 279, 358
BspCNI CTCAG 5 cut(s) 255, 316, 520, 526, 583
BspLI GGNNCC 3 cut(s) 80, 358, 540
BspT107I GGYRCC 1 cut(s) 78
BspTNI GGTCTC 1 cut(s) 489
BsrI ACTGG 1 cut(s) 441
BssECI CCNNGG 1 cut(s) 180
BssMI GATC 1 cut(s) 206
BssNI GRCGYC 1 cut(s) 79
BssSI CACGAG 1 cut(s) 365
BssT1I CCWWGG 1 cut(s) 180
Bst2BI CACGAG 1 cut(s) 365
Bst4CI ACNGT 2 cut(s) 115, 154
BstACI GRCGYC 1 cut(s) 79
BstC8I GCNNGC 3 cut(s) 7, 259, 390
BstDEI CTNAG 5 cut(s) 242, 324, 507, 534, 591
BstH2I RGCGCY 1 cut(s) 82
BstHHI GCGC 1 cut(s) 81
BstKTI GATC 1 cut(s) 209
BstMAI GTCTC 3 cut(s) 41, 489, 510
BstMBI GATC 1 cut(s) 206
BstMWI GCNNNNNNNGC 2 cut(s) 329, 430
BstNSI RCATGY 1 cut(s) 388
BstSFI CTRYAG 1 cut(s) 150
BstSLI GKGCMC 1 cut(s) 360
BsuRI GGCC 3 cut(s) 221, 279, 358
BtsIMutI CAGTG 1 cut(s) 159
Cac8I GCNNGC 3 cut(s) 7, 259, 390
CaiI CAGNNNCTG 1 cut(s) 436
CfoI GCGC 1 cut(s) 81
Cfr13I GGNCC 3 cut(s) 277, 356, 357
Csp6I GTAC 3 cut(s) 531, 578, 588
CviAII CATG 3 cut(s) 385, 412, 602
CviQI GTAC 3 cut(s) 531, 578, 588
DdeI CTNAG 5 cut(s) 242, 324, 507, 534, 591
DinI GGCGCC 1 cut(s) 80
DpnI GATC 1 cut(s) 208
DpnII GATC 1 cut(s) 206
DriI GACNNNNNGTC 1 cut(s) 502
EaeI YGGCCR 1 cut(s) 219
Eam1105I GACNNNNNGTC 1 cut(s) 502
Eco130I CCWWGG 1 cut(s) 180
Eco24I GRGCYC 2 cut(s) 263, 360
Eco31I GGTCTC 1 cut(s) 489
Eco88I CYCGRG 1 cut(s) 38
EcoO109I RGGNCCY 1 cut(s) 356
EcoT14I CCWWGG 1 cut(s) 180
EcoT38I GRGCYC 2 cut(s) 263, 360
EgeI GGCGCC 1 cut(s) 80
EheI GGCGCC 1 cut(s) 80
ErhI CCWWGG 1 cut(s) 180
FaeI CATG 3 cut(s) 388, 415, 605
FaiI YATR 6 cut(s) 74, 76, 275, 386, 413, 603
FaqI GGGAC 1 cut(s) 134
FatI CATG 3 cut(s) 384, 411, 601
FauI CCCGC 1 cut(s) 250
FblI GTMKAC 1 cut(s) 286
FriOI GRGCYC 2 cut(s) 263, 360
FspBI CTAG 1 cut(s) 162
GlaI GCGC 1 cut(s) 80
GsuI CTGGAG 1 cut(s) 537
HaeII RGCGCY 1 cut(s) 82
HaeIII GGCC 3 cut(s) 221, 279, 358
HhaI GCGC 1 cut(s) 81
Hin1I GRCGYC 1 cut(s) 79
Hin1II CATG 3 cut(s) 388, 415, 605
Hin6I GCGC 1 cut(s) 79
HinP1I GCGC 1 cut(s) 79
HinfI GANTC 9 cut(s) 34, 122, 166, 192, 215, 230, 311, 454, 479
HphI GGTGA 2 cut(s) 293, 516
Hpy166II GTNNAC 1 cut(s) 287
Hpy188I TCNGA 3 cut(s) 211, 453, 585
Hpy188III TCNNGA 5 cut(s) 38, 40, 65, 227, 516
Hpy8I GTNNAC 1 cut(s) 287
Hpy99I CGWCG 1 cut(s) 409
HpyAV CCTTC 2 cut(s) 97, 573
HpyCH4III ACNGT 2 cut(s) 115, 154
HpyCH4IV ACGT 1 cut(s) 283
HpyCH4V TGCA 1 cut(s) 392
HpyF10VI GCNNNNNNNGC 2 cut(s) 329, 430
HpyF3I CTNAG 5 cut(s) 242, 324, 507, 534, 591
HpySE526I ACGT 1 cut(s) 283
Hsp92I GRCGYC 1 cut(s) 79
Hsp92II CATG 3 cut(s) 388, 415, 605
HspAI GCGC 1 cut(s) 79
KasI GGCGCC 1 cut(s) 78
Kzo9I GATC 1 cut(s) 206
LmnI GCTCC 1 cut(s) 544
LpnPI CCDG 4 cut(s) 422, 443, 455, 501
MaeI CTAG 1 cut(s) 162
MaeII ACGT 1 cut(s) 283
MaeIII GTNAC 2 cut(s) 157, 378
MalI GATC 1 cut(s) 208
MboI GATC 1 cut(s) 206
MboII GAAGA 3 cut(s) 82, 145, 161
MhlI GDGCHC 2 cut(s) 263, 360
MluCI AATT 1 cut(s) 397
Mly113I GGCGCC 1 cut(s) 79
MlyI GAGTC 5 cut(s) 43, 116, 224, 224, 488
MmeI TCCRAC 1 cut(s) 431
MnlI CCTC 6 cut(s) 319, 347, 529, 564, 577, 586
MroXI GAANNNNTTC 1 cut(s) 196
MseI TTAA 2 cut(s) 99, 339
MwoI GCNNNNNNNGC 2 cut(s) 329, 430
NarI GGCGCC 1 cut(s) 79
NdeII GATC 1 cut(s) 206
NlaIII CATG 3 cut(s) 388, 415, 605
NlaIV GGNNCC 3 cut(s) 80, 358, 540
NspI RCATGY 1 cut(s) 388
PaeR7I CTCGAG 1 cut(s) 38
PdmI GAANNNNTTC 1 cut(s) 196
PfeI GAWTC 4 cut(s) 166, 192, 311, 454
PflMI CCANNNNNTGG 1 cut(s) 436
PleI GAGTC 5 cut(s) 42, 116, 223, 224, 487
PluTI GGCGCC 1 cut(s) 82
PpsI GAGTC 5 cut(s) 42, 116, 223, 224, 487
PspN4I GGNNCC 3 cut(s) 80, 358, 540
PspOMI GGGCCC 1 cut(s) 356
PspPI GGNCC 3 cut(s) 277, 356, 357
PstNI CAGNNNCTG 1 cut(s) 436
RsaI GTAC 3 cut(s) 532, 579, 589
RsaNI GTAC 3 cut(s) 531, 578, 588
SaqAI TTAA 2 cut(s) 99, 339
Sau3AI GATC 1 cut(s) 206
Sau96I GGNCC 3 cut(s) 277, 356, 357
ScaI AGTACT 2 cut(s) 532, 589
SchI GAGTC 5 cut(s) 43, 116, 224, 224, 488
SduI GDGCHC 2 cut(s) 263, 360
SetI ASST 9 cut(s) 21, 144, 286, 330, 426, 435, 451, 501, 556
SfcI CTRYAG 1 cut(s) 150
SfoI GGCGCC 1 cut(s) 80
Sfr274I CTCGAG 1 cut(s) 38
SlaI CTCGAG 1 cut(s) 38
SmlI CTYRAG 1 cut(s) 38
SmoI CTYRAG 1 cut(s) 38
Sse9I AATT 1 cut(s) 397
SsiI CCGC 2 cut(s) 147, 257
SspDI GGCGCC 1 cut(s) 78
SspMI CTAG 1 cut(s) 162
StyI CCWWGG 1 cut(s) 180
TaaI ACNGT 2 cut(s) 115, 154
TaiI ACGT 1 cut(s) 286
TaqI TCGA 5 cut(s) 39, 295, 404, 426, 477
TasI AATT 1 cut(s) 397
TatI WGTACW 2 cut(s) 530, 587
TfiI GAWTC 4 cut(s) 166, 192, 311, 454
Tru1I TTAA 2 cut(s) 99, 339
Tru9I TTAA 2 cut(s) 99, 339
TscAI CASTG 1 cut(s) 159
TspDTI ATGAA 3 cut(s) 146, 239, 428
TspRI CASTG 1 cut(s) 159
Van91I CCANNNNNTGG 1 cut(s) 436
XceI RCATGY 1 cut(s) 388
XhoI CTCGAG 1 cut(s) 38
XmiI GTMKAC 1 cut(s) 286
XmnI GAANNNNTTC 1 cut(s) 196
XspI CTAG 1 cut(s) 162
ZrmI AGTACT 2 cut(s) 532, 589
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.