pycom15g28640

ethylene-responsive transcription factor

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
Physical Location & Seq
Forward (+)
24702581 .. 24702892
312 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 312 bp
ATGGCTTGCCCATCTAACATTTGCTTAGATTTGAGTCTCAGGATTGATACAGACGAGCAGCGTCAGGATAACATATGGCGTCCGTCCTTCTCATCTTCTAATGGTCCTCTTACGGTTGGGGACTCTGTGATGAAGAATAACATAACTGCTACAGTGGTAGCCAGGAACTTCTCACTCCAAAGAACAACAGAATCCTTTCAAACCGGTCTGATGAGACGGCCGTTCAAGACTCATTGGCTCTCAGTGTTCAATGTGCGGGCTCTGTATCCAATATGGGTCAACGCCTACTTGCTCGATCGATCACCAAGTTGA

Protein Analysis

104

Amino Acids

11.77

Weight (kDa)

9.3

Isoelectric Point (pI)

70.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 256
AcoI YGGCCR 1 cut(s) 218
AcyI GRCGYC 1 cut(s) 79
AgeI ACCGGT 1 cut(s) 203
AgsI TTSAA 3 cut(s) 200, 226, 250
AjnI CCWGG 1 cut(s) 161
Alw26I GTCTC 2 cut(s) 41, 208
AoxI GGCC 1 cut(s) 218
ApeKI GCWGC 1 cut(s) 58
AsiGI ACCGGT 1 cut(s) 203
Asp700I GAANNNNTTC 1 cut(s) 195
AspS9I GGNCC 1 cut(s) 104
AsuHPI GGTGA 1 cut(s) 294
AvaII GGWCC 1 cut(s) 104
BanII GRGCYC 1 cut(s) 262
BbvI GCAGC 1 cut(s) 70
BccI CCATC 1 cut(s) 19
BceAI ACGGC 2 cut(s) 205, 233
BciT130I CCWGG 1 cut(s) 163
BciVI GTATCC 1 cut(s) 276
BcoDI GTCTC 2 cut(s) 41, 208
BfmI CTRYAG 1 cut(s) 150
BfuI GTATCC 1 cut(s) 276
BisI GCNGC 1 cut(s) 59
BlsI GCNGC 1 cut(s) 60
Bme1390I CCNGG 1 cut(s) 163
Bme18I GGWCC 1 cut(s) 104
BmgT120I GGNCC 1 cut(s) 104
BmrFI CCNGG 1 cut(s) 163
Bsa29I ATCGAT 1 cut(s) 298
BsaHI GRCGYC 1 cut(s) 79
BsaWI WCCGGW 1 cut(s) 203
Bse118I RCCGGY 1 cut(s) 203
BseBI CCWGG 1 cut(s) 163
BseCI ATCGAT 1 cut(s) 298
BseMII CTCAG 2 cut(s) 52, 255
BseX3I CGGCCG 1 cut(s) 218
BseXI GCAGC 1 cut(s) 70
Bsh1285I CGRYCG 2 cut(s) 221, 298
BshFI GGCC 1 cut(s) 220
BshTI ACCGGT 1 cut(s) 203
BshVI ATCGAT 1 cut(s) 298
BsiEI CGRYCG 2 cut(s) 221, 298
BsiSI CCGG 1 cut(s) 204
BslFI GGGAC 1 cut(s) 134
BsmAI GTCTC 2 cut(s) 41, 208
BsmBI CGTCTC 1 cut(s) 208
BsmFI GGGAC 1 cut(s) 134
BsnI GGCC 1 cut(s) 220
Bsp1286I GDGCHC 1 cut(s) 262
Bsp143I GATC 2 cut(s) 295, 299
BspACI CCGC 1 cut(s) 256
BspANI GGCC 1 cut(s) 220
BspCNI CTCAG 2 cut(s) 51, 254
BspDI ATCGAT 1 cut(s) 298
BsrFI RCCGGY 1 cut(s) 203
BssAI RCCGGY 1 cut(s) 203
BssMI GATC 2 cut(s) 295, 299
BssNI GRCGYC 1 cut(s) 79
Bst2UI CCWGG 1 cut(s) 163
Bst4CI ACNGT 2 cut(s) 115, 154
BstACI GRCGYC 1 cut(s) 79
BstC8I GCNNGC 2 cut(s) 7, 258
BstDEI CTNAG 3 cut(s) 25, 38, 241
BstKTI GATC 2 cut(s) 298, 302
BstMAI GTCTC 2 cut(s) 41, 208
BstMBI GATC 2 cut(s) 295, 299
BstMCI CGRYCG 2 cut(s) 221, 298
BstNI CCWGG 1 cut(s) 163
BstSCI CCNGG 1 cut(s) 161
BstSFI CTRYAG 1 cut(s) 150
BstV1I GCAGC 1 cut(s) 70
BstZI CGGCCG 1 cut(s) 218
Bsu15I ATCGAT 1 cut(s) 298
BsuI GTATCC 1 cut(s) 276
BsuRI GGCC 1 cut(s) 220
BsuTUI ATCGAT 1 cut(s) 298
BtsIMutI CAGTG 2 cut(s) 159, 249
Cac8I GCNNGC 2 cut(s) 7, 258
Cfr10I RCCGGY 1 cut(s) 203
Cfr13I GGNCC 1 cut(s) 104
ClaI ATCGAT 1 cut(s) 298
CseI GACGC 2 cut(s) 50, 68
CspAI ACCGGT 1 cut(s) 203
CviJI RGCY 5 cut(s) 5, 161, 220, 238, 260
CviKI_1 RGCY 5 cut(s) 5, 161, 220, 238, 260
DdeI CTNAG 3 cut(s) 25, 38, 241
DpnI GATC 2 cut(s) 297, 301
DpnII GATC 2 cut(s) 295, 299
EaeI YGGCCR 1 cut(s) 218
EagI CGGCCG 1 cut(s) 218
EclXI CGGCCG 1 cut(s) 218
Eco24I GRGCYC 1 cut(s) 262
Eco47I GGWCC 1 cut(s) 104
Eco52I CGGCCG 1 cut(s) 218
EcoRII CCWGG 1 cut(s) 161
EcoT38I GRGCYC 1 cut(s) 262
Esp3I CGTCTC 1 cut(s) 208
FaiI YATR 4 cut(s) 74, 76, 143, 274
FaqI GGGAC 1 cut(s) 134
FauI CCCGC 1 cut(s) 249
FauNDI CATATG 1 cut(s) 74
Fnu4HI GCNGC 1 cut(s) 59
FriOI GRGCYC 1 cut(s) 262
Fsp4HI GCNGC 1 cut(s) 59
GluI GCNGC 1 cut(s) 59
HaeIII GGCC 1 cut(s) 220
HapII CCGG 1 cut(s) 204
HgaI GACGC 2 cut(s) 50, 68
Hin1I GRCGYC 1 cut(s) 79
HincII GTYRAC 1 cut(s) 280
HindII GTYRAC 1 cut(s) 280
HinfI GANTC 4 cut(s) 34, 122, 191, 229
HpaII CCGG 1 cut(s) 204
HphI GGTGA 1 cut(s) 294
Hpy166II GTNNAC 1 cut(s) 280
Hpy188I TCNGA 1 cut(s) 210
Hpy188III TCNNGA 3 cut(s) 40, 65, 226
Hpy8I GTNNAC 1 cut(s) 280
HpyAV CCTTC 1 cut(s) 97
HpyCH4III ACNGT 2 cut(s) 115, 154
HpyF3I CTNAG 3 cut(s) 25, 38, 241
Hsp92I GRCGYC 1 cut(s) 79
Kzo9I GATC 2 cut(s) 295, 299
LpnPI CCDG 5 cut(s) 25, 50, 148, 175, 217
Lsp1109I GCAGC 1 cut(s) 70
MalI GATC 2 cut(s) 297, 301
MboI GATC 2 cut(s) 295, 299
MboII GAAGA 2 cut(s) 87, 145
MhlI GDGCHC 1 cut(s) 262
MlyI GAGTC 3 cut(s) 43, 116, 223
MnlI CCTC 1 cut(s) 117
MroXI GAANNNNTTC 1 cut(s) 195
MspI CCGG 1 cut(s) 204
MspR9I CCNGG 1 cut(s) 163
MvaI CCWGG 1 cut(s) 163
NdeI CATATG 1 cut(s) 74
NdeII GATC 2 cut(s) 295, 299
PdmI GAANNNNTTC 1 cut(s) 195
PfeI GAWTC 1 cut(s) 191
PinAI ACCGGT 1 cut(s) 203
PkrI GCNGC 1 cut(s) 60
Ple19I CGATCG 1 cut(s) 298
PleI GAGTC 3 cut(s) 42, 116, 223
PpsI GAGTC 3 cut(s) 42, 116, 223
Psp6I CCWGG 1 cut(s) 161
PspGI CCWGG 1 cut(s) 161
PspPI GGNCC 1 cut(s) 104
PvuI CGATCG 1 cut(s) 298
SatI GCNGC 1 cut(s) 59
Sau3AI GATC 2 cut(s) 295, 299
Sau96I GGNCC 1 cut(s) 104
SchI GAGTC 3 cut(s) 43, 116, 223
ScrFI CCNGG 1 cut(s) 163
SduI GDGCHC 1 cut(s) 262
SfcI CTRYAG 1 cut(s) 150
SinI GGWCC 1 cut(s) 104
SsiI CCGC 1 cut(s) 256
StyD4I CCNGG 1 cut(s) 161
TaaI ACNGT 2 cut(s) 115, 154
TaqI TCGA 2 cut(s) 294, 298
TfiI GAWTC 1 cut(s) 191
TscAI CASTG 2 cut(s) 159, 249
TseI GCWGC 1 cut(s) 58
TspDTI ATGAA 1 cut(s) 146
TspGWI ACGGA 1 cut(s) 72
TspRI CASTG 2 cut(s) 159, 249
VpaK11BI GGWCC 1 cut(s) 104
XmnI GAANNNNTTC 1 cut(s) 195
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.