pycom1681g00030

Nudix hydrolase 3-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00001681
Physical Location & Seq
Reverse (-)
44153 .. 50957
6805 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 555 bp
ATGCAGGACGCCACAACAGCTACAATAGTAGCTAGGAACCTCCTCACACCAAAAGATAGTAGGCTGCTGTCAGGACGGTCCGATGAGTTGGCCGTTCAAGAGTCCCTTGCACTTAGTGTTCAGTGTGCGAGTTCTGTGTCCAACATGGGCCAACGCCTGCTTGCCCGCTCCCGTCAGGTGGAATCATTGATGGCAGAGGTGGAAAGTCTCAAGGATAAAGTAATGGCTCGAATCAAACTGCTTAAGCATGAGAATAGAAGTTTGCACGTACTTGCCAACAACTATTCGACGGGCATGAAGAGGAAGCTTGATGAGCTGCAAGAATCTGAAGGTCGAATTCACAATGACCGTCAAAGGCTTGCGTCTTATCTCCAGAGGCACCTTTTTCCTGGGTCATCCAGCGCTTGGCCAAGTATTGAGGCCTGGAATGCTCTAGCTCCGATGCCTCCCGCTCCGATGGCTTCCGCTCCGATGCCTCCCGCTTCTATGCCTCCCGCTTCTGCGCCTTCCGCTTCTGCGCCTCGTAGTGGGGCTTCACGTAAACAACCTTTGTGA

Protein Analysis

185

Amino Acids

20.01

Weight (kDa)

9.99

Isoelectric Point (pI)

67.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 378
AccB7I CCANNNNNTGG 1 cut(s) 405
AccBSI CCGCTC 3 cut(s) 168, 452, 467
AciI CCGC 6 cut(s) 166, 450, 465, 480, 495, 510
AcoI YGGCCR 2 cut(s) 90, 407
AcsI RAATTY 1 cut(s) 336
AcuI CTGAAG 1 cut(s) 348
AcyI GRCGYC 1 cut(s) 9
AdeI CACNNNGTG 1 cut(s) 116
AfaI GTAC 1 cut(s) 270
AfeI AGCGCT 1 cut(s) 403
AfiI CCNNNNNNNGG 3 cut(s) 178, 405, 527
AflII CTTAAG 1 cut(s) 242
AgsI TTSAA 1 cut(s) 98
AjnI CCWGG 2 cut(s) 388, 422
AluBI AGCT 5 cut(s) 20, 32, 307, 316, 437
AluI AGCT 5 cut(s) 20, 32, 307, 316, 437
Alw26I GTCTC 1 cut(s) 212
Aor51HI AGCGCT 1 cut(s) 403
AoxI GGCC 4 cut(s) 90, 148, 407, 420
ApeKI GCWGC 2 cut(s) 64, 316
ApoI RAATTY 1 cut(s) 336
AspLEI GCGC 3 cut(s) 404, 505, 520
AspS9I GGNCC 2 cut(s) 78, 148
AvaII GGWCC 1 cut(s) 78
BalI TGGCCA 1 cut(s) 409
BanI GGYRCC 1 cut(s) 378
BarI GAAGNNNNNNTAC 2 cut(s) 517, 549
BbvI GCAGC 2 cut(s) 51, 303
BccI CCATC 2 cut(s) 184, 451
BceAI ACGGC 1 cut(s) 77
BciT130I CCWGG 2 cut(s) 390, 424
BcoDI GTCTC 1 cut(s) 212
BfaI CTAG 2 cut(s) 33, 434
BfoI RGCGCY 1 cut(s) 405
BfrI CTTAAG 1 cut(s) 242
BisI GCNGC 2 cut(s) 65, 317
BlsI GCNGC 2 cut(s) 66, 318
Bme1390I CCNGG 2 cut(s) 390, 424
Bme18I GGWCC 1 cut(s) 78
BmgT120I GGNCC 2 cut(s) 78, 148
BmiI GGNNCC 2 cut(s) 38, 380
BmrFI CCNGG 2 cut(s) 390, 424
BmsI GCATC 2 cut(s) 432, 462
BpmI CTGGAG 1 cut(s) 356
BpuEI CTTGAG 1 cut(s) 194
BsaAI YACGTR 2 cut(s) 268, 539
BsaHI GRCGYC 1 cut(s) 9
BsaJI CCNNGG 1 cut(s) 389
Bsc4I CCNNNNNNNGG 3 cut(s) 178, 405, 527
BseBI CCWGG 2 cut(s) 390, 424
BseDI CCNNGG 1 cut(s) 389
BseGI GGATG 1 cut(s) 395
BseLI CCNNNNNNNGG 3 cut(s) 178, 405, 527
BseRI GAGGAG 1 cut(s) 32
BseXI GCAGC 2 cut(s) 51, 303
BshFI GGCC 4 cut(s) 92, 150, 409, 422
BshNI GGYRCC 1 cut(s) 378
BslFI GGGAC 1 cut(s) 88
BslI CCNNNNNNNGG 3 cut(s) 178, 405, 527
BsmAI GTCTC 1 cut(s) 212
BsmFI GGGAC 1 cut(s) 88
BsmI GAATGC 1 cut(s) 433
BsnI GGCC 4 cut(s) 92, 150, 409, 422
BspACI CCGC 6 cut(s) 166, 450, 465, 480, 495, 510
BspANI GGCC 4 cut(s) 92, 150, 409, 422
BspLI GGNNCC 2 cut(s) 38, 380
BspT107I GGYRCC 1 cut(s) 378
BspTI CTTAAG 1 cut(s) 242
BsrBI CCGCTC 3 cut(s) 168, 452, 467
BssECI CCNNGG 1 cut(s) 389
BssNI GRCGYC 1 cut(s) 9
Bst2UI CCWGG 2 cut(s) 390, 424
Bst4CI ACNGT 2 cut(s) 78, 350
Bst6I CTCTTC 1 cut(s) 293
BstACI GRCGYC 1 cut(s) 9
BstAFI CTTAAG 1 cut(s) 242
BstBAI YACGTR 2 cut(s) 268, 539
BstC8I GCNNGC 4 cut(s) 158, 162, 166, 360
BstDEI CTNAG 1 cut(s) 113
BstF5I GGATG 1 cut(s) 395
BstH2I RGCGCY 1 cut(s) 405
BstHHI GCGC 3 cut(s) 404, 505, 520
BstMAI GTCTC 1 cut(s) 212
BstMWI GCNNNNNNNGC 5 cut(s) 17, 313, 428, 458, 509
BstNI CCWGG 2 cut(s) 390, 424
BstSCI CCNGG 2 cut(s) 388, 422
BstV1I GCAGC 2 cut(s) 51, 303
BsuRI GGCC 4 cut(s) 92, 150, 409, 422
BtsCI GGATG 1 cut(s) 395
BtsIMutI CAGTG 1 cut(s) 128
Cac8I GCNNGC 4 cut(s) 158, 162, 166, 360
CfoI GCGC 3 cut(s) 404, 505, 520
Cfr13I GGNCC 2 cut(s) 78, 148
CpoI CGGWCCG 1 cut(s) 78
CseI GACGC 2 cut(s) 17, 351
Csp6I GTAC 1 cut(s) 269
CspI CGGWCCG 1 cut(s) 78
CviAII CATG 3 cut(s) 145, 248, 295
CviQI GTAC 1 cut(s) 269
DdeI CTNAG 1 cut(s) 113
DraIII CACNNNGTG 1 cut(s) 116
EaeI YGGCCR 2 cut(s) 90, 407
Eam1104I CTCTTC 1 cut(s) 293
EarI CTCTTC 1 cut(s) 293
Eco147I AGGCCT 1 cut(s) 422
Eco47I GGWCC 1 cut(s) 78
Eco47III AGCGCT 1 cut(s) 403
Eco57I CTGAAG 1 cut(s) 348
EcoRI GAATTC 1 cut(s) 336
EcoRII CCWGG 2 cut(s) 388, 422
FaeI CATG 3 cut(s) 148, 251, 298
FaiI YATR 4 cut(s) 146, 249, 296, 488
FalI AAGNNNNNCTT 2 cut(s) 90, 122
FaqI GGGAC 1 cut(s) 88
FatI CATG 3 cut(s) 144, 247, 294
FauI CCCGC 4 cut(s) 173, 457, 487, 502
Fnu4HI GCNGC 2 cut(s) 65, 317
FokI GGATG 1 cut(s) 382
Fsp4HI GCNGC 2 cut(s) 65, 317
FspBI CTAG 2 cut(s) 33, 434
GlaI GCGC 3 cut(s) 403, 504, 519
GluI GCNGC 2 cut(s) 65, 317
GsuI CTGGAG 1 cut(s) 356
HaeII RGCGCY 1 cut(s) 405
HaeIII GGCC 4 cut(s) 92, 150, 409, 422
HgaI GACGC 2 cut(s) 17, 351
HhaI GCGC 3 cut(s) 404, 505, 520
Hin1I GRCGYC 1 cut(s) 9
Hin1II CATG 3 cut(s) 148, 251, 298
Hin6I GCGC 3 cut(s) 402, 503, 518
HinP1I GCGC 3 cut(s) 402, 503, 518
HindIII AAGCTT 1 cut(s) 305
HinfI GANTC 4 cut(s) 101, 182, 231, 323
Hpy166II GTNNAC 1 cut(s) 542
Hpy188I TCNGA 5 cut(s) 82, 328, 441, 456, 471
Hpy188III TCNNGA 3 cut(s) 72, 98, 373
Hpy8I GTNNAC 1 cut(s) 542
Hpy99I CGWCG 1 cut(s) 292
HpyAV CCTTC 2 cut(s) 323, 516
HpyCH4III ACNGT 2 cut(s) 78, 350
HpyCH4IV ACGT 2 cut(s) 267, 538
HpyCH4V TGCA 4 cut(s) 4, 110, 265, 319
HpyF10VI GCNNNNNNNGC 5 cut(s) 17, 313, 428, 458, 509
HpyF3I CTNAG 1 cut(s) 113
HpySE526I ACGT 2 cut(s) 267, 538
Hsp92I GRCGYC 1 cut(s) 9
Hsp92II CATG 3 cut(s) 148, 251, 298
HspAI GCGC 3 cut(s) 402, 503, 518
LmnI GCTCC 4 cut(s) 173, 442, 457, 472
LpnPI CCDG 9 cut(s) 57, 161, 170, 375, 386, 402, 409, 412, 436
Lsp1109I GCAGC 2 cut(s) 51, 303
LweI GCATC 2 cut(s) 432, 462
MaeI CTAG 2 cut(s) 33, 434
MaeII ACGT 2 cut(s) 267, 538
MbiI CCGCTC 3 cut(s) 168, 452, 467
MboII GAAGA 1 cut(s) 310
MlsI TGGCCA 1 cut(s) 409
MluCI AATT 1 cut(s) 336
MluNI TGGCCA 1 cut(s) 409
MlyI GAGTC 1 cut(s) 110
MmeI TCCRAC 1 cut(s) 165
Mox20I TGGCCA 1 cut(s) 409
MscI TGGCCA 1 cut(s) 409
MseI TTAA 1 cut(s) 243
Msp20I TGGCCA 1 cut(s) 409
MspCI CTTAAG 1 cut(s) 242
MspR9I CCNGG 2 cut(s) 390, 424
Mva1269I GAATGC 1 cut(s) 433
MvaI CCWGG 2 cut(s) 390, 424
MwoI GCNNNNNNNGC 5 cut(s) 17, 313, 428, 458, 509
NlaIII CATG 3 cut(s) 148, 251, 298
NlaIV GGNNCC 2 cut(s) 38, 380
PceI AGGCCT 1 cut(s) 422
PctI GAATGC 1 cut(s) 433
PfeI GAWTC 3 cut(s) 182, 231, 323
PflMI CCANNNNNTGG 1 cut(s) 405
PkrI GCNGC 2 cut(s) 66, 318
PleI GAGTC 1 cut(s) 109
PpsI GAGTC 1 cut(s) 109
Ppu21I YACGTR 2 cut(s) 268, 539
Psp6I CCWGG 2 cut(s) 388, 422
PspGI CCWGG 2 cut(s) 388, 422
PspN4I GGNNCC 2 cut(s) 38, 380
PspPI GGNCC 2 cut(s) 78, 148
RsaI GTAC 1 cut(s) 270
RsaNI GTAC 1 cut(s) 269
Rsr2I CGGWCCG 1 cut(s) 78
RsrII CGGWCCG 1 cut(s) 78
SaqAI TTAA 1 cut(s) 243
SatI GCNGC 2 cut(s) 65, 317
Sau96I GGNCC 2 cut(s) 78, 148
SchI GAGTC 1 cut(s) 110
ScrFI CCNGG 2 cut(s) 390, 424
SfaNI GCATC 2 cut(s) 432, 462
SinI GGWCC 1 cut(s) 78
SmlI CTYRAG 2 cut(s) 209, 242
SmoI CTYRAG 2 cut(s) 209, 242
Sse9I AATT 1 cut(s) 336
SseBI AGGCCT 1 cut(s) 422
SsiI CCGC 6 cut(s) 166, 450, 465, 480, 495, 510
SspMI CTAG 2 cut(s) 33, 434
StuI AGGCCT 1 cut(s) 422
StyD4I CCNGG 2 cut(s) 388, 422
TaaI ACNGT 2 cut(s) 78, 350
TaiI ACGT 2 cut(s) 270, 541
TaqI TCGA 3 cut(s) 229, 287, 334
TasI AATT 1 cut(s) 336
TfiI GAWTC 3 cut(s) 182, 231, 323
Tru1I TTAA 1 cut(s) 243
Tru9I TTAA 1 cut(s) 243
TscAI CASTG 1 cut(s) 128
TseI GCWGC 2 cut(s) 64, 316
TspDTI ATGAA 1 cut(s) 311
TspRI CASTG 1 cut(s) 128
Van91I CCANNNNNTGG 1 cut(s) 405
Vha464I CTTAAG 1 cut(s) 242
VpaK11BI GGWCC 1 cut(s) 78
XapI RAATTY 1 cut(s) 336
XspI CTAG 2 cut(s) 33, 434
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.