pycom16g22140

Nudix hydrolase 3-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
Physical Location & Seq
Reverse (-)
21700809 .. 21708106
7298 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 783 bp
ATGATAGCTGGAAATGAAAGGGAAAGCTGGAAAGTGGAAGGGATGCACGGCATGGATGTTTTGGTGCATGTGTTGGCTGATTTGGTTGTTGGGAAAAACATGTGTTTGCATGTGAATGGGTTGGCAAACCCATCGAACCTTAGCTTGGAATTGAGCCTTAGCAGTGATACGGGTGTGCCGCGTCAAGGTAACATATGGCGCCCTTCTTTCTTATCTTCTAACGGTCCTCTCACAGGTGAAGACTCCGTGATGCAGGACGCCACAACAGCTACAATAGTAGCTAGGAACCTCCTCACTCCAAAAGATAGCAGGCTGCTGTCAGGACGGTCCGATGAGTTGGCCGTTCAAGAGTCCCTCGCACTTAGTGTTCAGTGTGCGAGTTCTGTGTCCAACATGGGCCAACGCCTGCTTGCCCGCTCCCGTCAGGTGGAATCATTGATGGCGGAGGTGGAAAGTCTTAAGCAAGAGATCAAACTGCTTAAGTACGAGAATAGAAGTTTGCATGTGCTTGCAAACAACTATTCGACGGGCATGAAGAGGAAGCTTGATGAGCTGCAAGAATCCAATGGTCGCATGCAAAGTGACCGTCAAAGGCTTGCGGCTTACTTCCAGAGGCACATTTTTCCTGGCTCGTCCAGCGTTTGGCCAAGTATTGAGGCCTCGAATGCTCTATCTTTGATGTCTTCCACTCCGATGCCTTCCGCTCCGATGCCTTCCGCCTCGATGCCTTCTGCTTCTAGAGTTTTGCCAAGGAGTGGGGCTTCAAGCAAACAACCTTTGTGA

Protein Analysis

261

Amino Acids

28.23

Weight (kDa)

8.6

Isoelectric Point (pI)

56.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 198
AccB7I CCANNNNNTGG 2 cut(s) 642, 755
AccBSI CCGCTC 2 cut(s) 417, 704
AccII CGCG 1 cut(s) 181
AciI CCGC 6 cut(s) 179, 415, 443, 599, 702, 717
AcoI YGGCCR 2 cut(s) 339, 644
AcyI GRCGYC 2 cut(s) 199, 258
AdeI CACNNNGTG 1 cut(s) 365
AfaI GTAC 1 cut(s) 485
AfiI CCNNNNNNNGG 6 cut(s) 145, 185, 233, 427, 642, 755
AflII CTTAAG 2 cut(s) 458, 479
AflIII ACRYGT 1 cut(s) 99
AgsI TTSAA 2 cut(s) 347, 765
AjnI CCWGG 1 cut(s) 625
AjuI GAANNNNNNNTTGG 2 cut(s) 128, 160
AluBI AGCT 7 cut(s) 8, 27, 144, 269, 281, 544, 553
AluI AGCT 7 cut(s) 8, 27, 144, 269, 281, 544, 553
AoxI GGCC 4 cut(s) 339, 397, 644, 657
ApeKI GCWGC 2 cut(s) 313, 553
ArsI GACNNNNNNTTYG 2 cut(s) 571, 603
AspLEI GCGC 1 cut(s) 201
AspS9I GGNCC 3 cut(s) 224, 327, 397
AsuHPI GGTGA 1 cut(s) 248
AvaII GGWCC 2 cut(s) 224, 327
BaeI ACNNNNGTAYC 2 cut(s) 159, 192
BalI TGGCCA 1 cut(s) 646
BanI GGYRCC 1 cut(s) 198
BbsI GAAGAC 2 cut(s) 246, 675
BbvI GCAGC 2 cut(s) 300, 540
BccI CCATC 2 cut(s) 139, 433
BceAI ACGGC 2 cut(s) 64, 326
BcgI CGANNNNNNTGC 2 cut(s) 114, 148
BciT130I CCWGG 1 cut(s) 627
BfaI CTAG 2 cut(s) 282, 738
BfoI RGCGCY 1 cut(s) 202
BfrI CTTAAG 2 cut(s) 458, 479
BisI GCNGC 4 cut(s) 179, 314, 554, 600
BlsI GCNGC 4 cut(s) 180, 315, 555, 601
Bme1390I CCNGG 1 cut(s) 627
Bme18I GGWCC 2 cut(s) 224, 327
BmgT120I GGNCC 3 cut(s) 224, 327, 397
BmiI GGNNCC 2 cut(s) 200, 287
BmrFI CCNGG 1 cut(s) 627
BmsI GCATC 5 cut(s) 33, 240, 684, 699, 714
BpiI GAAGAC 2 cut(s) 246, 675
Bpu10I CCTNAGC 2 cut(s) 140, 158
BsaHI GRCGYC 2 cut(s) 199, 258
BsaJI CCNNGG 1 cut(s) 749
Bsc4I CCNNNNNNNGG 6 cut(s) 145, 185, 233, 427, 642, 755
BseBI CCWGG 1 cut(s) 627
BseDI CCNNGG 1 cut(s) 749
BseGI GGATG 2 cut(s) 48, 61
BseLI CCNNNNNNNGG 6 cut(s) 145, 185, 233, 427, 642, 755
BseRI GAGGAG 1 cut(s) 281
BseXI GCAGC 2 cut(s) 300, 540
Bsh1236I CGCG 1 cut(s) 181
BshFI GGCC 4 cut(s) 341, 399, 646, 659
BshNI GGYRCC 1 cut(s) 198
BslFI GGGAC 1 cut(s) 337
BslI CCNNNNNNNGG 6 cut(s) 145, 185, 233, 427, 642, 755
BsmFI GGGAC 1 cut(s) 337
BsmI GAATGC 1 cut(s) 670
BsnI GGCC 4 cut(s) 341, 399, 646, 659
Bsp143I GATC 1 cut(s) 468
BspACI CCGC 6 cut(s) 179, 415, 443, 599, 702, 717
BspANI GGCC 4 cut(s) 341, 399, 646, 659
BspFNI CGCG 1 cut(s) 181
BspLI GGNNCC 2 cut(s) 200, 287
BspT107I GGYRCC 1 cut(s) 198
BspTI CTTAAG 2 cut(s) 458, 479
BsrBI CCGCTC 2 cut(s) 417, 704
BssECI CCNNGG 1 cut(s) 749
BssMI GATC 1 cut(s) 468
BssNI GRCGYC 2 cut(s) 199, 258
BssT1I CCWWGG 1 cut(s) 749
Bst2UI CCWGG 1 cut(s) 627
Bst4CI ACNGT 3 cut(s) 224, 327, 587
Bst6I CTCTTC 1 cut(s) 530
BstACI GRCGYC 2 cut(s) 199, 258
BstAFI CTTAAG 2 cut(s) 458, 479
BstC8I GCNNGC 7 cut(s) 311, 407, 411, 415, 510, 575, 597
BstDEI CTNAG 3 cut(s) 140, 158, 362
BstENI CCTNNNNNAGG 1 cut(s) 231
BstF5I GGATG 2 cut(s) 48, 61
BstFNI CGCG 1 cut(s) 181
BstH2I RGCGCY 1 cut(s) 202
BstHHI GCGC 1 cut(s) 201
BstKTI GATC 1 cut(s) 471
BstMBI GATC 1 cut(s) 468
BstMWI GCNNNNNNNGC 4 cut(s) 266, 550, 636, 665
BstNI CCWGG 1 cut(s) 627
BstNSI RCATGY 5 cut(s) 71, 103, 113, 506, 577
BstSCI CCNGG 1 cut(s) 625
BstUI CGCG 1 cut(s) 181
BstV1I GCAGC 2 cut(s) 300, 540
BstV2I GAAGAC 2 cut(s) 246, 675
BsuRI GGCC 4 cut(s) 341, 399, 646, 659
BtsCI GGATG 2 cut(s) 48, 61
BtsI GCAGTG 1 cut(s) 169
BtsIMutI CAGTG 2 cut(s) 169, 377
Cac8I GCNNGC 7 cut(s) 311, 407, 411, 415, 510, 575, 597
CfoI GCGC 1 cut(s) 201
Cfr13I GGNCC 3 cut(s) 224, 327, 397
CpoI CGGWCCG 1 cut(s) 327
CseI GACGC 2 cut(s) 170, 266
Csp6I GTAC 1 cut(s) 484
CspI CGGWCCG 1 cut(s) 327
CviAII CATG 8 cut(s) 52, 68, 100, 110, 394, 503, 532, 574
CviQI GTAC 1 cut(s) 484
DdeI CTNAG 3 cut(s) 140, 158, 362
DinI GGCGCC 1 cut(s) 200
DpnI GATC 1 cut(s) 470
DpnII GATC 1 cut(s) 468
DraIII CACNNNGTG 1 cut(s) 365
EaeI YGGCCR 2 cut(s) 339, 644
Eam1104I CTCTTC 1 cut(s) 530
EarI CTCTTC 1 cut(s) 530
EciI GGCGGA 2 cut(s) 458, 706
Eco130I CCWWGG 1 cut(s) 749
Eco147I AGGCCT 1 cut(s) 659
Eco47I GGWCC 2 cut(s) 224, 327
EcoNI CCTNNNNNAGG 1 cut(s) 231
EcoRII CCWGG 1 cut(s) 625
EcoT14I CCWWGG 1 cut(s) 749
EgeI GGCGCC 1 cut(s) 200
EheI GGCGCC 1 cut(s) 200
ErhI CCWWGG 1 cut(s) 749
FaeI CATG 8 cut(s) 55, 71, 103, 113, 397, 506, 535, 577
FaqI GGGAC 1 cut(s) 337
FatI CATG 8 cut(s) 51, 67, 99, 109, 393, 502, 531, 573
FauI CCCGC 1 cut(s) 422
FauNDI CATATG 1 cut(s) 194
Fnu4HI GCNGC 4 cut(s) 179, 314, 554, 600
FokI GGATG 2 cut(s) 55, 68
Fsp4HI GCNGC 4 cut(s) 179, 314, 554, 600
FspBI CTAG 2 cut(s) 282, 738
GlaI GCGC 1 cut(s) 200
GluI GCNGC 4 cut(s) 179, 314, 554, 600
HaeII RGCGCY 1 cut(s) 202
HaeIII GGCC 4 cut(s) 341, 399, 646, 659
HgaI GACGC 2 cut(s) 170, 266
HhaI GCGC 1 cut(s) 201
Hin1I GRCGYC 2 cut(s) 199, 258
Hin1II CATG 8 cut(s) 55, 71, 103, 113, 397, 506, 535, 577
Hin6I GCGC 1 cut(s) 199
HinP1I GCGC 1 cut(s) 199
HindIII AAGCTT 1 cut(s) 542
HinfI GANTC 4 cut(s) 242, 350, 431, 560
HphI GGTGA 1 cut(s) 248
Hpy188I TCNGA 3 cut(s) 331, 693, 708
Hpy188III TCNNGA 4 cut(s) 321, 347, 610, 738
Hpy99I CGWCG 1 cut(s) 529
HpyAV CCTTC 5 cut(s) 32, 213, 708, 723, 738
HpyCH4III ACNGT 3 cut(s) 224, 327, 587
HpyCH4V TGCA 8 cut(s) 46, 67, 109, 253, 502, 512, 556, 577
HpyF10VI GCNNNNNNNGC 4 cut(s) 266, 550, 636, 665
HpyF3I CTNAG 3 cut(s) 140, 158, 362
Hsp92I GRCGYC 2 cut(s) 199, 258
Hsp92II CATG 8 cut(s) 55, 71, 103, 113, 397, 506, 535, 577
HspAI GCGC 1 cut(s) 199
KasI GGCGCC 1 cut(s) 198
Kzo9I GATC 1 cut(s) 468
LmnI GCTCC 2 cut(s) 422, 709
Lsp1109I GCAGC 2 cut(s) 300, 540
LweI GCATC 5 cut(s) 33, 240, 684, 699, 714
MaeI CTAG 2 cut(s) 282, 738
MaeIII GTNAC 2 cut(s) 188, 581
MalI GATC 1 cut(s) 470
MbiI CCGCTC 2 cut(s) 417, 704
MboI GATC 1 cut(s) 468
MboII GAAGA 4 cut(s) 207, 251, 547, 675
MlsI TGGCCA 1 cut(s) 646
MluCI AATT 1 cut(s) 149
MluNI TGGCCA 1 cut(s) 646
Mly113I GGCGCC 1 cut(s) 199
MlyI GAGTC 2 cut(s) 236, 359
MmeI TCCRAC 1 cut(s) 414
Mox20I TGGCCA 1 cut(s) 646
MscI TGGCCA 1 cut(s) 646
MseI TTAA 2 cut(s) 459, 480
MslI CAYNNNNRTG 2 cut(s) 114, 692
Msp20I TGGCCA 1 cut(s) 646
MspCI CTTAAG 2 cut(s) 458, 479
MspR9I CCNGG 1 cut(s) 627
Mva1269I GAATGC 1 cut(s) 670
MvaI CCWGG 1 cut(s) 627
MvnI CGCG 1 cut(s) 181
MwoI GCNNNNNNNGC 4 cut(s) 266, 550, 636, 665
NarI GGCGCC 1 cut(s) 199
NdeI CATATG 1 cut(s) 194
NdeII GATC 1 cut(s) 468
NlaIII CATG 8 cut(s) 55, 71, 103, 113, 397, 506, 535, 577
NlaIV GGNNCC 2 cut(s) 200, 287
NmuCI GTSAC 1 cut(s) 581
NspI RCATGY 5 cut(s) 71, 103, 113, 506, 577
PaeI GCATGC 1 cut(s) 577
PceI AGGCCT 1 cut(s) 659
PciI ACATGT 1 cut(s) 99
PctI GAATGC 1 cut(s) 670
PfeI GAWTC 2 cut(s) 431, 560
PflMI CCANNNNNTGG 2 cut(s) 642, 755
PkrI GCNGC 4 cut(s) 180, 315, 555, 601
PleI GAGTC 2 cut(s) 236, 358
PluTI GGCGCC 1 cut(s) 202
PpsI GAGTC 2 cut(s) 236, 358
PscI ACATGT 1 cut(s) 99
Psp6I CCWGG 1 cut(s) 625
PspGI CCWGG 1 cut(s) 625
PspN4I GGNNCC 2 cut(s) 200, 287
PspPI GGNCC 3 cut(s) 224, 327, 397
RsaI GTAC 1 cut(s) 485
RsaNI GTAC 1 cut(s) 484
RseI CAYNNNNRTG 2 cut(s) 114, 692
Rsr2I CGGWCCG 1 cut(s) 327
RsrII CGGWCCG 1 cut(s) 327
SaqAI TTAA 2 cut(s) 459, 480
SatI GCNGC 4 cut(s) 179, 314, 554, 600
Sau3AI GATC 1 cut(s) 468
Sau96I GGNCC 3 cut(s) 224, 327, 397
SchI GAGTC 2 cut(s) 236, 359
ScrFI CCNGG 1 cut(s) 627
SfaNI GCATC 5 cut(s) 33, 240, 684, 699, 714
SfoI GGCGCC 1 cut(s) 200
SinI GGWCC 2 cut(s) 224, 327
SmiMI CAYNNNNRTG 2 cut(s) 114, 692
SmlI CTYRAG 2 cut(s) 458, 479
SmoI CTYRAG 2 cut(s) 458, 479
SphI GCATGC 1 cut(s) 577
Sse9I AATT 1 cut(s) 149
SseBI AGGCCT 1 cut(s) 659
SsiI CCGC 6 cut(s) 179, 415, 443, 599, 702, 717
SspDI GGCGCC 1 cut(s) 198
SspMI CTAG 2 cut(s) 282, 738
StuI AGGCCT 1 cut(s) 659
StyD4I CCNGG 1 cut(s) 625
StyI CCWWGG 1 cut(s) 749
TaaI ACNGT 3 cut(s) 224, 327, 587
TaqI TCGA 4 cut(s) 134, 524, 662, 722
TasI AATT 1 cut(s) 149
TauI GCSGC 2 cut(s) 181, 602
TfiI GAWTC 2 cut(s) 431, 560
Tru1I TTAA 2 cut(s) 459, 480
Tru9I TTAA 2 cut(s) 459, 480
TscAI CASTG 2 cut(s) 169, 377
TseFI GTSAC 1 cut(s) 581
TseI GCWGC 2 cut(s) 313, 553
Tsp45I GTSAC 1 cut(s) 581
TspDTI ATGAA 2 cut(s) 30, 548
TspGWI ACGGA 1 cut(s) 235
TspRI CASTG 2 cut(s) 169, 377
Van91I CCANNNNNTGG 2 cut(s) 642, 755
Vha464I CTTAAG 2 cut(s) 458, 479
VpaK11BI GGWCC 2 cut(s) 224, 327
XagI CCTNNNNNAGG 1 cut(s) 231
XbaI TCTAGA 1 cut(s) 737
XceI RCATGY 5 cut(s) 71, 103, 113, 506, 577
XspI CTAG 2 cut(s) 282, 738
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.